Mutagenetix > Incidental Mutations

Incidental Mutation 'R6547:Nr3c2'

521280

Institutional Source

Beutler Lab

Gene Symbol

Nr3c2

Ensembl Gene

ENSMUSG00000031618

Gene Name

nuclear receptor subfamily 3, group C, member 2

Synonyms

MR, aldosterone receptor, mineralocorticoid receptor, Mlr

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6547 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

76899442-77245012 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 76908809 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 180 (I180F)

Ref Sequence

ENSEMBL: ENSMUSP00000105537 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034031] [ENSMUST00000109911] [ENSMUST00000109912] [ENSMUST00000109913] [ENSMUST00000128862] [ENSMUST00000143284] [ENSMUST00000148106]

Predicted Effect

probably benign
Transcript: ENSMUST00000034031
AA Change: I180F

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000034031
Gene: ENSMUSG00000031618
AA Change: I180F

Domain	Start	End	E-Value	Type
low complexity region	212	222	N/A	INTRINSIC
low complexity region	259	277	N/A	INTRINSIC
low complexity region	280	300	N/A	INTRINSIC
low complexity region	346	354	N/A	INTRINSIC
low complexity region	584	598	N/A	INTRINSIC
ZnF_C4	600	675	1.89e-31	SMART
low complexity region	690	706	N/A	INTRINSIC
HOLI	771	935	7.78e-33	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109911
AA Change: I180F

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000105537
Gene: ENSMUSG00000031618
AA Change: I180F

Domain	Start	End	E-Value	Type
low complexity region	212	222	N/A	INTRINSIC
low complexity region	259	277	N/A	INTRINSIC
low complexity region	280	300	N/A	INTRINSIC
low complexity region	346	354	N/A	INTRINSIC
low complexity region	584	598	N/A	INTRINSIC
ZnF_C4	600	671	5.29e-35	SMART
HOLI	658	818	1.1e-23	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000109912
AA Change: I180F

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000105538
Gene: ENSMUSG00000031618
AA Change: I180F

Domain	Start	End	E-Value	Type
low complexity region	212	222	N/A	INTRINSIC
low complexity region	259	277	N/A	INTRINSIC
low complexity region	280	300	N/A	INTRINSIC
low complexity region	346	354	N/A	INTRINSIC
low complexity region	584	598	N/A	INTRINSIC
ZnF_C4	600	671	5.29e-35	SMART
low complexity region	686	702	N/A	INTRINSIC
HOLI	767	931	7.78e-33	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000109913
AA Change: I180F

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000105539
Gene: ENSMUSG00000031618
AA Change: I180F

Domain	Start	End	E-Value	Type
low complexity region	212	222	N/A	INTRINSIC
low complexity region	259	277	N/A	INTRINSIC
low complexity region	280	300	N/A	INTRINSIC
low complexity region	346	354	N/A	INTRINSIC
low complexity region	584	598	N/A	INTRINSIC
ZnF_C4	600	671	5.29e-35	SMART
low complexity region	686	702	N/A	INTRINSIC
HOLI	767	931	7.78e-33	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000128862

Predicted Effect

probably benign
Transcript: ENSMUST00000143284

Predicted Effect

probably benign
Transcript: ENSMUST00000148106
AA Change: I180F

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000118222
Gene: ENSMUSG00000031618
AA Change: I180F

Domain	Start	End	E-Value	Type
low complexity region	212	222	N/A	INTRINSIC
low complexity region	259	277	N/A	INTRINSIC
low complexity region	280	300	N/A	INTRINSIC
low complexity region	346	354	N/A	INTRINSIC
low complexity region	584	598	N/A	INTRINSIC
ZnF_C4	600	671	5.29e-35	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.2%
20x: 97.4%

Validation Efficiency

98% (53/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the mineralocorticoid receptor, which mediates aldosterone actions on salt and water balance within restricted target cells. The protein functions as a ligand-dependent transcription factor that binds to mineralocorticoid response elements in order to transactivate target genes. Mutations in this gene cause autosomal dominant pseudohypoaldosteronism type I, a disorder characterized by urinary salt wasting. Defects in this gene are also associated with early onset hypertension with severe exacerbation in pregnancy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit weight loss and symptoms of pseudohypoaldosteronism, and eventually die at around day 10 after birth from renal salt wasting and dehydration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932414N04Rik	A	T	2: 68,659,907		probably benign	Het
9230113P08Rik	T	A	9: 35,908,485	M15K	probably null	Het
Abca13	T	A	11: 9,274,757	V490E	probably benign	Het
Abca2	G	T	2: 25,433,338	G106V	possibly damaging	Het
Ablim3	T	C	18: 61,823,929	T276A	probably benign	Het
Anxa7	A	G	14: 20,469,393	V119A	probably benign	Het
Arl9	A	G	5: 77,010,410		probably null	Het
Atm	T	C	9: 53,440,157	Y2964C	probably damaging	Het
Bbs9	T	C	9: 22,514,069	Y140H	probably benign	Het
Calcr	A	T	6: 3,717,177	D94E	probably damaging	Het
Celsr3	T	A	9: 108,829,128	Y937N	probably damaging	Het
Clca3a1	C	T	3: 144,736,947	A779T	probably damaging	Het
Clec9a	T	A	6: 129,416,376	V94D	probably benign	Het
Colec12	G	T	18: 9,840,351	L57F	probably damaging	Het
Fa2h	T	C	8: 111,348,020	Y317C	probably damaging	Het
Fam126a	T	C	5: 23,965,100	N417S	probably benign	Het
Flnc	A	G	6: 29,448,608	T1282A	probably damaging	Het
Gm10801	AAGT	AAGTAGT	2: 98,663,803		probably null	Het
Hcn2	G	T	10: 79,717,152	V162L	probably benign	Het
Kbtbd11	T	A	8: 15,027,641	V80E	possibly damaging	Het
Lama4	A	G	10: 39,073,656	D915G	probably damaging	Het
Limch1	A	T	5: 67,028,774	E806V	probably damaging	Het
Mppe1	T	C	18: 67,228,988	I169V	probably benign	Het
Msc	A	C	1: 14,755,745	S2A	possibly damaging	Het
Nploc4	A	G	11: 120,428,522		probably null	Het
Nrap	G	T	19: 56,351,566	H840N	probably benign	Het
Olfr151	T	A	9: 37,730,495	M163L	probably benign	Het
Pdlim1	G	A	19: 40,223,120	T243I	probably damaging	Het
Pfkl	T	A	10: 77,995,354	M318L	probably benign	Het
Rap1gds1	C	A	3: 138,955,338	R426L	probably damaging	Het
Ric1	A	G	19: 29,594,826	N674D	probably damaging	Het
Rp1	G	A	1: 4,170,305	T875I	unknown	Het
Rtn1	G	T	12: 72,308,761	S137Y	possibly damaging	Het
Scn2a	A	G	2: 65,715,897	I935V	probably benign	Het
Serpina1a	C	T	12: 103,855,921	V251M	probably damaging	Het
Slc19a3	A	G	1: 83,022,900	V132A	probably damaging	Het
Slc26a6	T	A	9: 108,860,782		probably null	Het
Slc2a5	T	A	4: 150,135,619	V164D	possibly damaging	Het
Slc4a1	T	A	11: 102,356,735	T441S	probably damaging	Het
Stk33	T	C	7: 109,320,835	I366V	possibly damaging	Het
Syt14	G	T	1: 192,901,869	H696N	possibly damaging	Het
Tcaim	T	A	9: 122,814,466	V77D	probably benign	Het
Tefm	T	G	11: 80,140,384		probably null	Het
Tekt3	T	A	11: 63,070,478	S158T	possibly damaging	Het
Tmem2	A	T	19: 21,844,831	T1197S	probably benign	Het
Tspan11	T	A	6: 127,949,803	M238K	possibly damaging	Het
Unc5c	A	T	3: 141,790,019	T476S	probably benign	Het
Usp9y	A	T	Y: 1,444,612	L109Q	probably damaging	Homo
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Vps13c	C	A	9: 67,973,365	Q3495K	probably damaging	Het
Zbtb10	G	A	3: 9,251,703	A192T	probably benign	Het
Zfp316	A	T	5: 143,254,197	V689D	probably damaging	Het
Zswim1	A	G	2: 164,824,796		probably benign	Het
Zswim5	T	C	4: 116,986,903	L1046P	probably damaging	Het

Other mutations in Nr3c2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00691:Nr3c2	APN	8	76909590	missense	possibly damaging	0.82
IGL01019:Nr3c2	APN	8	76909214	missense	probably damaging	0.99
IGL01085:Nr3c2	APN	8	76908354	missense	probably benign	0.02
IGL01395:Nr3c2	APN	8	76908848	missense	possibly damaging	0.73
IGL01505:Nr3c2	APN	8	76909187	missense	probably damaging	1.00
IGL01656:Nr3c2	APN	8	77187537	missense	probably damaging	1.00
IGL01802:Nr3c2	APN	8	76908595	nonsense	probably null
IGL02147:Nr3c2	APN	8	76909067	missense	probably damaging	0.98
IGL02502:Nr3c2	APN	8	77242514	missense	probably damaging	1.00
IGL02706:Nr3c2	APN	8	76908416	splice site	probably null
IGL02945:Nr3c2	APN	8	76909659	missense	probably damaging	1.00
IGL03034:Nr3c2	APN	8	77187638	nonsense	probably null
IGL03162:Nr3c2	APN	8	77217584	missense	probably damaging	0.99
naughty	UTSW	8	76908668	splice site	probably null
R0141:Nr3c2	UTSW	8	76908408	missense	probably damaging	0.99
R0422:Nr3c2	UTSW	8	77185967	missense	probably benign
R0458:Nr3c2	UTSW	8	76909538	missense	probably damaging	1.00
R0595:Nr3c2	UTSW	8	76909604	missense	possibly damaging	0.93
R0615:Nr3c2	UTSW	8	77185889	missense	probably benign	0.05
R0964:Nr3c2	UTSW	8	76908668	splice site	probably null
R0989:Nr3c2	UTSW	8	77187564	missense	probably damaging	0.97
R1532:Nr3c2	UTSW	8	76909104	missense	probably damaging	0.99
R1624:Nr3c2	UTSW	8	76909944	missense	probably damaging	1.00
R1737:Nr3c2	UTSW	8	76908329	missense	probably benign	0.16
R1965:Nr3c2	UTSW	8	76909463	missense	probably damaging	0.99
R2011:Nr3c2	UTSW	8	76909793	missense	possibly damaging	0.53
R2110:Nr3c2	UTSW	8	76908527	missense	possibly damaging	0.75
R2281:Nr3c2	UTSW	8	76909907	missense	probably damaging	0.99
R3782:Nr3c2	UTSW	8	77085684	splice site	probably null
R3808:Nr3c2	UTSW	8	76908714	missense	probably damaging	1.00
R4133:Nr3c2	UTSW	8	76909749	missense	probably damaging	1.00
R4433:Nr3c2	UTSW	8	77217467	missense	probably damaging	1.00
R4738:Nr3c2	UTSW	8	76909307	missense	possibly damaging	0.94
R4770:Nr3c2	UTSW	8	76908243	splice site	probably null
R4884:Nr3c2	UTSW	8	76908809	missense	possibly damaging	0.53
R5169:Nr3c2	UTSW	8	76909037	missense	probably damaging	1.00
R5347:Nr3c2	UTSW	8	77210748	missense	possibly damaging	0.92
R5857:Nr3c2	UTSW	8	76908867	missense	possibly damaging	0.53
R5878:Nr3c2	UTSW	8	76908268	critical splice acceptor site	probably null
R6262:Nr3c2	UTSW	8	76908633	missense	possibly damaging	0.65
R6820:Nr3c2	UTSW	8	77242457	missense	probably damaging	0.98
R7180:Nr3c2	UTSW	8	76908963	missense	probably damaging	0.99
R7672:Nr3c2	UTSW	8	76909209	missense	probably damaging	1.00
R7741:Nr3c2	UTSW	8	77210646	missense	probably damaging	0.97
R7776:Nr3c2	UTSW	8	76909545	missense	possibly damaging	0.77
R7800:Nr3c2	UTSW	8	76909992	missense	probably damaging	1.00
Z1088:Nr3c2	UTSW	8	76908632	missense	possibly damaging	0.48
Z1176:Nr3c2	UTSW	8	76909700	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TGTGAGAGATGCCGAGTACAC -3'
(R):5'- GCCTCTATTTTCAACACTGGGG -3'

Sequencing Primer
(F):5'- GATGCCGAGTACACTTATGATCAGC -3'
(R):5'- TTCAACACTGGGGGAGCATGTC -3'

Posted On

2018-06-06