Incidental Mutation 'R6585:4930522L14Rik'
List [record 1 of 31] next >> last >|
ID524333
Institutional Source Beutler Lab
Gene Symbol 4930522L14Rik
Ensembl Gene ENSMUSG00000072762
Gene NameRIKEN cDNA 4930522L14 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R6585 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location109735990-109751886 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 109737668 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 108 (C108Y)
Ref Sequence ENSEMBL: ENSMUSP00000108166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100937] [ENSMUST00000112547]
Predicted Effect probably benign
Transcript: ENSMUST00000100937
SMART Domains Protein: ENSMUSP00000098497
Gene: ENSMUSG00000072762

DomainStartEndE-ValueType
KRAB 4 64 5.37e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112547
AA Change: C108Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108166
Gene: ENSMUSG00000072762
AA Change: C108Y

DomainStartEndE-ValueType
KRAB 4 66 7.19e-16 SMART
ZnF_C2H2 103 125 2.75e-3 SMART
ZnF_C2H2 131 153 1.72e-4 SMART
ZnF_C2H2 159 181 7.9e-4 SMART
ZnF_C2H2 187 209 1.04e-3 SMART
ZnF_C2H2 215 237 1.1e-2 SMART
ZnF_C2H2 243 265 3.89e-3 SMART
ZnF_C2H2 271 294 3.69e-4 SMART
ZnF_C2H2 300 322 5.9e-3 SMART
ZnF_C2H2 328 350 1.56e-2 SMART
ZnF_C2H2 356 378 1.18e-2 SMART
ZnF_C2H2 384 406 9.08e-4 SMART
ZnF_C2H2 412 434 1.98e-4 SMART
ZnF_C2H2 440 462 2.61e-4 SMART
ZnF_C2H2 468 491 1.38e-3 SMART
ZnF_C2H2 497 519 3.39e-3 SMART
ZnF_C2H2 525 547 1.4e-4 SMART
ZnF_C2H2 553 576 1.95e-3 SMART
ZnF_C2H2 582 604 5.14e-3 SMART
ZnF_C2H2 610 632 1.67e-2 SMART
ZnF_C2H2 638 660 1.72e-4 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 97% (30/31)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA792892 C T 5: 94,381,556 P62S probably benign Het
Adam1b G T 5: 121,501,187 D598E probably benign Het
Agr2 G A 12: 35,995,626 R37Q probably benign Het
Ascc3 A G 10: 50,842,177 K1989E probably benign Het
Chd1l A G 3: 97,597,772 F160L probably damaging Het
Ciita T A 16: 10,511,745 V628E probably benign Het
Dis3l2 T A 1: 86,745,494 I69N probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Elp2 T C 18: 24,625,549 L503S probably damaging Het
Fcgbp A T 7: 28,113,979 Q2313L possibly damaging Het
Gm14851 A G 8: 21,095,232 C65R possibly damaging Het
Gpr155 A T 2: 73,349,645 I157N probably damaging Het
Hist2h2bb A T 3: 96,270,097 T116S probably benign Het
Kcnj1 T C 9: 32,397,261 V307A probably benign Het
Lama3 G A 18: 12,419,257 probably null Het
Lrp6 A T 6: 134,507,558 Y367* probably null Het
Ms4a14 T A 19: 11,303,645 Q516H unknown Het
Nprl3 C T 11: 32,234,812 R399Q probably benign Het
Olfr273 A T 4: 52,856,192 M107K possibly damaging Het
Olfr290 A T 7: 84,916,462 I228F probably damaging Het
Park7 G T 4: 150,905,264 Q80K probably benign Het
Pramef20 C A 4: 144,377,030 L175F possibly damaging Het
Ptgs2 T C 1: 150,103,987 V281A possibly damaging Het
Rprd1a T C 18: 24,506,663 probably null Het
Speer4f2 A G 5: 17,374,422 E73G probably damaging Het
Spta1 T C 1: 174,178,685 W138R probably damaging Het
U2surp T C 9: 95,472,071 E838G probably damaging Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Usp19 G T 9: 108,499,727 L1165F probably damaging Het
Zfp27 G A 7: 29,896,393 T49I possibly damaging Het
Other mutations in 4930522L14Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02622:4930522L14Rik APN 5 109739235 missense possibly damaging 0.86
R0164:4930522L14Rik UTSW 5 109736847 missense probably damaging 0.96
R0164:4930522L14Rik UTSW 5 109736847 missense probably damaging 0.96
R0432:4930522L14Rik UTSW 5 109736919 missense probably damaging 1.00
R0463:4930522L14Rik UTSW 5 109737060 unclassified probably benign
R0891:4930522L14Rik UTSW 5 109736290 missense possibly damaging 0.47
R1289:4930522L14Rik UTSW 5 109736890 nonsense probably null
R1637:4930522L14Rik UTSW 5 109738992 missense probably benign 0.01
R1764:4930522L14Rik UTSW 5 109736789 missense probably benign 0.22
R1793:4930522L14Rik UTSW 5 109736278 missense probably damaging 1.00
R1860:4930522L14Rik UTSW 5 109736232 missense probably damaging 1.00
R1899:4930522L14Rik UTSW 5 109736798 missense probably benign 0.04
R2135:4930522L14Rik UTSW 5 109737643 missense probably benign 0.00
R2143:4930522L14Rik UTSW 5 109736750 missense probably damaging 1.00
R2877:4930522L14Rik UTSW 5 109738945 splice site probably benign
R3847:4930522L14Rik UTSW 5 109736324 splice site probably null
R4431:4930522L14Rik UTSW 5 109736574 missense possibly damaging 0.47
R4578:4930522L14Rik UTSW 5 109736671 nonsense probably null
R4611:4930522L14Rik UTSW 5 109737393 missense probably benign 0.00
R4776:4930522L14Rik UTSW 5 109736873 missense probably benign 0.22
R4921:4930522L14Rik UTSW 5 109737796 missense probably benign 0.25
R4937:4930522L14Rik UTSW 5 109736201 missense probably benign 0.12
R4952:4930522L14Rik UTSW 5 109739197 critical splice donor site probably null
R4980:4930522L14Rik UTSW 5 109737426 missense probably damaging 1.00
R5079:4930522L14Rik UTSW 5 109737330 missense probably benign
R5088:4930522L14Rik UTSW 5 109736073 missense probably damaging 1.00
R5143:4930522L14Rik UTSW 5 109739198 critical splice donor site probably null
R5183:4930522L14Rik UTSW 5 109739305 missense probably damaging 1.00
R5461:4930522L14Rik UTSW 5 109736777 missense possibly damaging 0.74
R5498:4930522L14Rik UTSW 5 109737547 missense probably benign 0.05
R5576:4930522L14Rik UTSW 5 109737704 missense probably benign 0.00
R6081:4930522L14Rik UTSW 5 109739231 missense probably damaging 1.00
R6387:4930522L14Rik UTSW 5 109737015 missense possibly damaging 0.88
R6509:4930522L14Rik UTSW 5 109737384 nonsense probably null
R7309:4930522L14Rik UTSW 5 109736953 missense probably damaging 1.00
R7740:4930522L14Rik UTSW 5 109737504 nonsense probably null
R7877:4930522L14Rik UTSW 5 109736364 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATAGGGTTTGTGTTCAGTATGCA -3'
(R):5'- AGAAGGATTCTATAAATGTGAGCCAT -3'

Sequencing Primer
(F):5'- GCATTCGAAGATTACCAGGGTATAC -3'
(R):5'- GTGAGCCATGTAATAACACTCTTACC -3'
Posted On2018-06-22