Incidental Mutation 'R6585:Nprl3'
ID 524355
Institutional Source Beutler Lab
Gene Symbol Nprl3
Ensembl Gene ENSMUSG00000020289
Gene Name nitrogen permease regulator-like 3
Synonyms Mare, HS-26, Prox1, Phg, -14 gene, HS-40, m(alpha)RE
MMRRC Submission 044709-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.224) question?
Stock # R6585 (G1)
Quality Score 212.009
Status Validated
Chromosome 11
Chromosomal Location 32181963-32217707 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 32184812 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 399 (R399Q)
Ref Sequence ENSEMBL: ENSMUSP00000105016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020528] [ENSMUST00000020530] [ENSMUST00000109389] [ENSMUST00000124640] [ENSMUST00000136903] [ENSMUST00000137950] [ENSMUST00000141859] [ENSMUST00000142964] [ENSMUST00000138050]
AlphaFold Q8VIJ8
Predicted Effect probably benign
Transcript: ENSMUST00000020528
SMART Domains Protein: ENSMUSP00000020528
Gene: ENSMUSG00000020287

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
Pfam:Pur_DNA_glyco 109 304 1.2e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000020530
AA Change: R424Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020530
Gene: ENSMUSG00000020289
AA Change: R424Q

DomainStartEndE-ValueType
Blast:DSPc 1 77 3e-27 BLAST
Pfam:NPR3 104 418 1.8e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109389
AA Change: R399Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105016
Gene: ENSMUSG00000020289
AA Change: R399Q

DomainStartEndE-ValueType
Pfam:NPR3 63 108 8.3e-15 PFAM
Pfam:NPR3 104 395 3.1e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109390
Predicted Effect probably benign
Transcript: ENSMUST00000124640
SMART Domains Protein: ENSMUSP00000122085
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Blast:DSPc 1 68 2e-30 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125256
Predicted Effect probably benign
Transcript: ENSMUST00000136903
Predicted Effect probably benign
Transcript: ENSMUST00000137950
SMART Domains Protein: ENSMUSP00000115594
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Blast:DSPc 1 68 2e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000141859
SMART Domains Protein: ENSMUSP00000120341
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Blast:DSPc 1 59 2e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000142964
SMART Domains Protein: ENSMUSP00000118208
Gene: ENSMUSG00000020287

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
SCOP:d1ewna_ 102 125 5e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146890
Predicted Effect probably benign
Transcript: ENSMUST00000138050
SMART Domains Protein: ENSMUSP00000121960
Gene: ENSMUSG00000020287

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
SCOP:d1ewna_ 102 125 5e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148636
Meta Mutation Damage Score 0.0735 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency 97% (30/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The function of the encoded protein is not known. [provided by RefSeq, Aug 2011]
PHENOTYPE: This gene is deleted in the Hbath-J mutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930522L14Rik C T 5: 109,885,534 (GRCm39) C108Y probably damaging Het
Adam1b G T 5: 121,639,250 (GRCm39) D598E probably benign Het
Agr2 G A 12: 36,045,625 (GRCm39) R37Q probably benign Het
Ascc3 A G 10: 50,718,273 (GRCm39) K1989E probably benign Het
Chd1l A G 3: 97,505,088 (GRCm39) F160L probably damaging Het
Ciita T A 16: 10,329,609 (GRCm39) V628E probably benign Het
Defa38 A G 8: 21,585,248 (GRCm39) C65R possibly damaging Het
Dis3l2 T A 1: 86,673,216 (GRCm39) I69N probably damaging Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Homo
Elp2 T C 18: 24,758,606 (GRCm39) L503S probably damaging Het
Fcgbp A T 7: 27,813,404 (GRCm39) Q2313L possibly damaging Het
Gpr155 A T 2: 73,179,989 (GRCm39) I157N probably damaging Het
H2bc18 A T 3: 96,177,413 (GRCm39) T116S probably benign Het
Kcnj1 T C 9: 32,308,557 (GRCm39) V307A probably benign Het
Lama3 G A 18: 12,552,314 (GRCm39) probably null Het
Lrp6 A T 6: 134,484,521 (GRCm39) Y367* probably null Het
Ms4a14 T A 19: 11,281,009 (GRCm39) Q516H unknown Het
Or13c3 A T 4: 52,856,192 (GRCm39) M107K possibly damaging Het
Or5ae1 A T 7: 84,565,670 (GRCm39) I228F probably damaging Het
Park7 G T 4: 150,989,721 (GRCm39) Q80K probably benign Het
Pramel15 C A 4: 144,103,600 (GRCm39) L175F possibly damaging Het
Pramel52-ps C T 5: 94,529,415 (GRCm39) P62S probably benign Het
Ptgs2 T C 1: 149,979,738 (GRCm39) V281A possibly damaging Het
Rprd1a T C 18: 24,639,720 (GRCm39) probably null Het
Speer4f2 A G 5: 17,579,420 (GRCm39) E73G probably damaging Het
Spta1 T C 1: 174,006,251 (GRCm39) W138R probably damaging Het
U2surp T C 9: 95,354,124 (GRCm39) E838G probably damaging Het
Urb2 G T 8: 124,757,864 (GRCm39) E1190D probably damaging Het
Usp19 G T 9: 108,376,926 (GRCm39) L1165F probably damaging Het
Zfp27 G A 7: 29,595,818 (GRCm39) T49I possibly damaging Het
Other mutations in Nprl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02410:Nprl3 APN 11 32,217,539 (GRCm39) start codon destroyed probably null 0.99
IGL03055:Nprl3 APN 11 32,198,230 (GRCm39) intron probably benign
IGL03366:Nprl3 APN 11 32,200,256 (GRCm39) missense probably damaging 1.00
R0114:Nprl3 UTSW 11 32,189,784 (GRCm39) unclassified probably benign
R0555:Nprl3 UTSW 11 32,183,118 (GRCm39) critical splice acceptor site probably null
R0620:Nprl3 UTSW 11 32,184,876 (GRCm39) missense probably damaging 1.00
R2008:Nprl3 UTSW 11 32,182,973 (GRCm39) missense probably damaging 0.97
R2172:Nprl3 UTSW 11 32,184,894 (GRCm39) missense probably benign 0.00
R2884:Nprl3 UTSW 11 32,198,163 (GRCm39) missense probably damaging 1.00
R3713:Nprl3 UTSW 11 32,205,464 (GRCm39) missense probably damaging 0.98
R3836:Nprl3 UTSW 11 32,183,082 (GRCm39) missense probably damaging 1.00
R4354:Nprl3 UTSW 11 32,184,906 (GRCm39) missense probably benign 0.00
R6052:Nprl3 UTSW 11 32,205,453 (GRCm39) missense possibly damaging 0.92
R6056:Nprl3 UTSW 11 32,217,432 (GRCm39) missense probably damaging 0.98
R6307:Nprl3 UTSW 11 32,189,828 (GRCm39) missense probably damaging 1.00
R6553:Nprl3 UTSW 11 32,184,812 (GRCm39) missense probably benign
R6774:Nprl3 UTSW 11 32,187,381 (GRCm39) missense probably damaging 1.00
R6806:Nprl3 UTSW 11 32,217,509 (GRCm39) missense probably damaging 0.99
R7746:Nprl3 UTSW 11 32,198,150 (GRCm39) nonsense probably null
R7980:Nprl3 UTSW 11 32,187,357 (GRCm39) missense probably damaging 1.00
R8483:Nprl3 UTSW 11 32,213,083 (GRCm39) missense probably damaging 1.00
R8712:Nprl3 UTSW 11 32,187,334 (GRCm39) missense possibly damaging 0.84
R8827:Nprl3 UTSW 11 32,184,742 (GRCm39) missense probably benign 0.00
R9264:Nprl3 UTSW 11 32,183,948 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCAACAGTACCCAGGCTTC -3'
(R):5'- CTTCCCGTTTAGGTACTGGG -3'

Sequencing Primer
(F):5'- AACAGTACCCAGGCTTCTTGGATG -3'
(R):5'- TCCCCAGGAATAGGAATCTGTTC -3'
Posted On 2018-06-22