Incidental Mutation 'R6624:Lrriq4'
List |< first << previous [record 17 of 33] next >> last >|
ID524649
Institutional Source Beutler Lab
Gene Symbol Lrriq4
Ensembl Gene ENSMUSG00000027703
Gene Nameleucine-rich repeats and IQ motif containing 4
Synonyms4930558O21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R6624 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location30644507-30672431 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30650780 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 319 (H319L)
Ref Sequence ENSEMBL: ENSMUSP00000127052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029252] [ENSMUST00000108265] [ENSMUST00000108267] [ENSMUST00000172350]
Predicted Effect probably benign
Transcript: ENSMUST00000029252
SMART Domains Protein: ENSMUSP00000029252
Gene: ENSMUSG00000027702

DomainStartEndE-ValueType
LRR 73 100 2.23e2 SMART
LRR 101 128 6.92e-1 SMART
LRR 129 156 1.78e0 SMART
LRR 157 184 1.67e-2 SMART
Blast:LRR 216 242 2e-9 BLAST
LRR 244 271 2.57e-3 SMART
LRR 272 299 5.59e-4 SMART
LRR 301 328 4.16e0 SMART
LRR 329 356 1.66e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108265
AA Change: H304L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000103900
Gene: ENSMUSG00000027703
AA Change: H304L

DomainStartEndE-ValueType
LRR 68 90 7.05e-1 SMART
LRR 91 114 1.19e1 SMART
Pfam:LRR_7 115 133 1.1e-1 PFAM
LRR 138 161 9.75e0 SMART
LRR 162 185 8.72e0 SMART
LRR 208 230 3.47e0 SMART
LRR 231 254 9.3e-1 SMART
LRR 255 276 1.22e2 SMART
LRR 277 300 4.83e0 SMART
LRR 323 345 6.22e0 SMART
LRR 346 368 6.4e0 SMART
LRR 369 392 1.51e0 SMART
LRR 418 440 2.03e1 SMART
LRR 441 464 2.82e0 SMART
IQ 524 546 8.84e-3 SMART
low complexity region 553 581 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108267
AA Change: H319L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000103902
Gene: ENSMUSG00000027703
AA Change: H319L

DomainStartEndE-ValueType
LRR 83 105 7.05e-1 SMART
LRR 106 129 1.19e1 SMART
Pfam:LRR_7 130 148 1.2e-1 PFAM
LRR 153 176 9.75e0 SMART
LRR 177 200 8.72e0 SMART
LRR 223 245 3.47e0 SMART
LRR 246 269 9.3e-1 SMART
LRR 270 291 1.22e2 SMART
LRR 292 315 4.83e0 SMART
LRR 338 360 6.22e0 SMART
LRR 361 383 6.4e0 SMART
LRR 384 407 1.51e0 SMART
LRR 433 455 2.03e1 SMART
LRR 456 479 2.82e0 SMART
IQ 539 561 8.84e-3 SMART
low complexity region 568 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172350
AA Change: H319L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000127052
Gene: ENSMUSG00000027703
AA Change: H319L

DomainStartEndE-ValueType
LRR 83 105 7.05e-1 SMART
LRR 106 129 1.19e1 SMART
LRR 153 176 9.75e0 SMART
LRR 177 200 8.72e0 SMART
LRR 223 245 3.47e0 SMART
LRR 246 269 9.3e-1 SMART
LRR 270 291 1.22e2 SMART
LRR 292 315 4.83e0 SMART
LRR 338 360 6.22e0 SMART
LRR 361 383 6.4e0 SMART
LRR 384 407 1.51e0 SMART
LRR 433 455 2.03e1 SMART
LRR 456 479 2.82e0 SMART
IQ 539 561 8.84e-3 SMART
low complexity region 568 596 N/A INTRINSIC
Meta Mutation Damage Score 0.0828 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (32/32)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank3 G A 10: 69,904,468 E852K possibly damaging Het
Cib3 T A 8: 72,205,738 I96F probably damaging Het
Ckap5 C T 2: 91,577,651 P841S probably benign Het
Col25a1 A G 3: 130,566,451 probably null Het
Col27a1 A T 4: 63,225,011 H312L probably benign Het
Cyp2j7 A G 4: 96,227,618 I197T probably damaging Het
Cyp4f40 C T 17: 32,671,180 R275C possibly damaging Het
Eif3l T C 15: 79,089,929 S515P probably damaging Het
Enpp1 A T 10: 24,669,755 Y262* probably null Het
Ergic3 T A 2: 156,016,898 M286K probably damaging Het
Ern2 C T 7: 122,177,783 A305T probably benign Het
Fam187b A G 7: 30,977,187 I40M probably benign Het
Fcho1 T G 8: 71,709,371 K798T probably damaging Het
Iah1 C T 12: 21,319,784 Q100* probably null Het
Jak2 T C 19: 29,282,589 I296T probably damaging Het
Lats2 A G 14: 57,694,312 probably null Het
Man2b1 A G 8: 85,096,853 N939D probably benign Het
Meis1 T C 11: 19,016,215 T53A probably benign Het
Nadsyn1 C T 7: 143,805,973 E421K probably benign Het
Olfr512 T C 7: 108,713,536 I49T possibly damaging Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pmfbp1 T C 8: 109,530,190 S509P possibly damaging Het
Pou4f3 A T 18: 42,395,642 I217F probably damaging Het
Ppara C A 15: 85,791,036 N235K probably benign Het
Prrg2 T C 7: 45,059,986 Y73C probably damaging Het
Sdccag8 T A 1: 176,874,812 probably null Het
Thap12 T G 7: 98,715,586 Y320* probably null Het
Trpm6 A G 19: 18,796,439 probably null Het
Trpm6 T A 19: 18,889,020 C1978S probably damaging Het
Usp33 A G 3: 152,381,798 Y708C probably damaging Het
Wdr3 G A 3: 100,144,326 T669M probably damaging Het
Zdbf2 T C 1: 63,303,914 I484T possibly damaging Het
Other mutations in Lrriq4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Lrriq4 APN 3 30650955 splice site probably null
IGL01289:Lrriq4 APN 3 30650393 missense probably damaging 1.00
IGL02130:Lrriq4 APN 3 30650747 missense probably damaging 0.99
IGL02614:Lrriq4 APN 3 30655639 missense probably damaging 1.00
R0329:Lrriq4 UTSW 3 30655724 missense probably benign 0.03
R1340:Lrriq4 UTSW 3 30650323 missense possibly damaging 0.46
R1440:Lrriq4 UTSW 3 30650761 missense probably damaging 1.00
R1446:Lrriq4 UTSW 3 30650578 missense probably benign 0.00
R1597:Lrriq4 UTSW 3 30650888 missense probably damaging 1.00
R1763:Lrriq4 UTSW 3 30650252 missense probably benign 0.19
R1923:Lrriq4 UTSW 3 30659093 missense probably benign 0.13
R4024:Lrriq4 UTSW 3 30650273 missense possibly damaging 0.46
R4026:Lrriq4 UTSW 3 30650273 missense possibly damaging 0.46
R4645:Lrriq4 UTSW 3 30650743 missense probably benign 0.20
R4816:Lrriq4 UTSW 3 30660047 missense possibly damaging 0.73
R5049:Lrriq4 UTSW 3 30650937 missense probably damaging 0.97
R5105:Lrriq4 UTSW 3 30650483 missense probably damaging 1.00
R5298:Lrriq4 UTSW 3 30645332 start codon destroyed probably null
R5487:Lrriq4 UTSW 3 30659995 missense probably benign 0.16
R6147:Lrriq4 UTSW 3 30659079 missense probably damaging 1.00
R6421:Lrriq4 UTSW 3 30650402 missense probably damaging 1.00
R6452:Lrriq4 UTSW 3 30655733 missense probably damaging 1.00
R7032:Lrriq4 UTSW 3 30655701 nonsense probably null
R8111:Lrriq4 UTSW 3 30655781 missense possibly damaging 0.87
Z1177:Lrriq4 UTSW 3 30649996 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TGCAGAAGTTCTACGTGGCG -3'
(R):5'- TCCAGAAGGGAAGCAGTACC -3'

Sequencing Primer
(F):5'- CAGAAGTTCTACGTGGCGTCTAAC -3'
(R):5'- ACCTGCCTCACTTTGTTATCATCTAG -3'
Posted On2018-06-22