Incidental Mutation 'R6629:Dlgap2'
ID524986
Institutional Source Beutler Lab
Gene Symbol Dlgap2
Ensembl Gene ENSMUSG00000047495
Gene NameDLG associated protein 2
SynonymsPSD-95/SAP90-binding protein 2, DAP2, Sapap2, 6430596N04Rik, SAP90/PSD-95-associated protein 2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6629 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location14095865-14847680 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 14831465 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 846 (T846A)
Ref Sequence ENSEMBL: ENSMUSP00000123078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043279] [ENSMUST00000133298] [ENSMUST00000150247] [ENSMUST00000152652]
Predicted Effect probably benign
Transcript: ENSMUST00000043279
AA Change: T845A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000039647
Gene: ENSMUSG00000047495
AA Change: T845A

DomainStartEndE-ValueType
low complexity region 269 294 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 446 456 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
Pfam:GKAP 707 1059 1.5e-151 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129119
Predicted Effect probably benign
Transcript: ENSMUST00000133298
AA Change: T845A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000119613
Gene: ENSMUSG00000047495
AA Change: T845A

DomainStartEndE-ValueType
low complexity region 269 294 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 446 456 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
Pfam:GKAP 707 1059 1.5e-151 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141214
Predicted Effect probably benign
Transcript: ENSMUST00000150247
AA Change: T831A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123104
Gene: ENSMUSG00000047495
AA Change: T831A

DomainStartEndE-ValueType
low complexity region 269 294 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 446 456 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
Pfam:GKAP 707 1045 1e-151 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152652
AA Change: T846A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000123078
Gene: ENSMUSG00000047495
AA Change: T846A

DomainStartEndE-ValueType
low complexity region 270 295 N/A INTRINSIC
low complexity region 298 311 N/A INTRINSIC
low complexity region 447 457 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 615 629 N/A INTRINSIC
Pfam:GKAP 715 1060 1.9e-160 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a membrane-associated protein that may play a role in synapse organization and signalling in neuronal cells. This gene is biallelically expressed in the brain, however, only the paternal allele is expressed in the testis (PMID:18055845). Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik T C 18: 57,730,780 S219P possibly damaging Het
Atxn3 A T 12: 101,937,406 M180K probably benign Het
Bnip2 G T 9: 70,002,111 R236L probably null Het
Boc T C 16: 44,492,361 D582G probably benign Het
Cacul1 T C 19: 60,580,367 S118G probably benign Het
Cpa2 A T 6: 30,554,194 D271V probably damaging Het
Cubn G A 2: 13,430,872 T1091M probably damaging Het
Eif5 G T 12: 111,543,608 A329S probably damaging Het
Fam136b-ps G A 15: 31,276,816 probably benign Het
Gnrhr A G 5: 86,182,309 V284A probably benign Het
Grin3a A G 4: 49,844,991 S31P probably damaging Het
Hectd2 T C 19: 36,615,538 L701P probably damaging Het
Hook1 C T 4: 96,001,270 T241I probably benign Het
Kif5a A G 10: 127,248,254 V52A probably damaging Het
Lasp1 T A 11: 97,806,896 Y11* probably null Het
Meltf A G 16: 31,885,076 Y207C probably damaging Het
Mllt3 ACTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCTACTACTACTGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCT ACTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCTACTACTACTGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCT 4: 87,841,267 probably benign Het
Nek1 A G 8: 61,054,333 probably null Het
Notch2 C A 3: 98,120,881 N969K possibly damaging Het
Olfr1221 T A 2: 89,112,162 M117L probably benign Het
Pcnx2 C T 8: 125,891,112 G135R probably benign Het
Pla2g4f A T 2: 120,308,242 L242Q probably damaging Het
Plcxd2 T G 16: 45,965,107 T312P probably damaging Het
Prpf4 G A 4: 62,417,860 V275I possibly damaging Het
Prpf8 G A 11: 75,495,426 probably null Het
Pxn T C 5: 115,554,062 L401P probably damaging Het
Rab44 A T 17: 29,135,780 probably benign Het
Rfx6 C A 10: 51,725,490 T669K probably benign Het
Rgs16 A G 1: 153,743,674 N142S probably damaging Het
Rhobtb1 A G 10: 69,270,316 E237G possibly damaging Het
Rsbn1 A C 3: 103,928,441 D265A probably damaging Het
Rufy4 A G 1: 74,132,367 probably null Het
Slc4a1 C A 11: 102,361,222 E19* probably null Het
Tctn1 A G 5: 122,242,668 S526P probably damaging Het
Tspear A T 10: 77,870,509 H371L probably benign Het
Vmn1r34 A T 6: 66,637,515 F80I probably benign Het
Wdr75 G A 1: 45,812,056 S264N probably damaging Het
Zfp652 A T 11: 95,763,790 N340Y probably damaging Het
Zp3 A G 5: 135,987,336 T306A probably benign Het
Other mutations in Dlgap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01476:Dlgap2 APN 8 14778301 nonsense probably null
IGL01788:Dlgap2 APN 8 14843631 missense probably benign 0.19
IGL02054:Dlgap2 APN 8 14843552 missense probably damaging 0.98
IGL02969:Dlgap2 APN 8 14831579 missense possibly damaging 0.95
IGL03183:Dlgap2 APN 8 14727525 missense possibly damaging 0.62
IGL03303:Dlgap2 APN 8 14727812 missense probably damaging 0.99
PIT4403001:Dlgap2 UTSW 8 14831528 missense probably damaging 1.00
R0026:Dlgap2 UTSW 8 14727363 nonsense probably null
R0242:Dlgap2 UTSW 8 14727562 missense probably benign 0.34
R0242:Dlgap2 UTSW 8 14727562 missense probably benign 0.34
R0647:Dlgap2 UTSW 8 14727591 missense possibly damaging 0.95
R1221:Dlgap2 UTSW 8 14726952 missense probably benign 0.08
R1374:Dlgap2 UTSW 8 14831228 splice site probably benign
R1440:Dlgap2 UTSW 8 14727060 missense probably benign
R1544:Dlgap2 UTSW 8 14829861 splice site probably null
R1550:Dlgap2 UTSW 8 14822499 missense probably damaging 0.98
R1804:Dlgap2 UTSW 8 14727809 missense possibly damaging 0.71
R1870:Dlgap2 UTSW 8 14773347 missense probably damaging 1.00
R1921:Dlgap2 UTSW 8 14843624 missense probably benign 0.10
R2119:Dlgap2 UTSW 8 14778206 missense possibly damaging 0.69
R2193:Dlgap2 UTSW 8 14743431 missense possibly damaging 0.51
R4381:Dlgap2 UTSW 8 14846502 missense probably benign
R4422:Dlgap2 UTSW 8 14743463 critical splice donor site probably null
R4521:Dlgap2 UTSW 8 14727871 missense probably damaging 1.00
R4581:Dlgap2 UTSW 8 14846679 missense probably damaging 1.00
R4585:Dlgap2 UTSW 8 14727999 critical splice donor site probably null
R4760:Dlgap2 UTSW 8 14773380 missense probably damaging 1.00
R5077:Dlgap2 UTSW 8 14822691 missense probably benign 0.35
R5373:Dlgap2 UTSW 8 14823614 missense probably benign 0.19
R5374:Dlgap2 UTSW 8 14823614 missense probably benign 0.19
R5552:Dlgap2 UTSW 8 14831342 nonsense probably null
R5964:Dlgap2 UTSW 8 14727128 nonsense probably null
R6125:Dlgap2 UTSW 8 14727193 missense possibly damaging 0.78
R6147:Dlgap2 UTSW 8 14727294 missense probably benign 0.05
R6163:Dlgap2 UTSW 8 14846641 missense probably damaging 1.00
R6269:Dlgap2 UTSW 8 14822369 missense probably benign 0.01
R6765:Dlgap2 UTSW 8 14743284 missense probably benign 0.00
R6809:Dlgap2 UTSW 8 14179619 intron probably benign
R6913:Dlgap2 UTSW 8 14778374 missense probably benign 0.10
R7219:Dlgap2 UTSW 8 14743296 missense probably benign 0.00
R7485:Dlgap2 UTSW 8 14829952 missense probably damaging 0.97
R7560:Dlgap2 UTSW 8 14822697 critical splice donor site probably null
X0060:Dlgap2 UTSW 8 14839787 missense probably damaging 1.00
Z1088:Dlgap2 UTSW 8 14822472 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TGCAGGCTGACTTAGAGCTG -3'
(R):5'- TACCGTACTGTGGGGAAAGC -3'

Sequencing Primer
(F):5'- ACTTAGAGCTGGAGGGTTTCCC -3'
(R):5'- AAAGCCGGGTTCTTACTGTC -3'
Posted On2018-06-22