Incidental Mutation 'R6629:Slc4a1'
ID 525004
Institutional Source Beutler Lab
Gene Symbol Slc4a1
Ensembl Gene ENSMUSG00000006574
Gene Name solute carrier family 4 (anion exchanger), member 1
Synonyms band 3, CD233, Ae1, erythrocyte membrane protein band 3, l11Jus51, Empb3
MMRRC Submission 044751-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6629 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 102239646-102256107 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 102252048 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 19 (E19*)
Ref Sequence ENSEMBL: ENSMUSP00000006749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006749]
AlphaFold P04919
Predicted Effect probably null
Transcript: ENSMUST00000006749
AA Change: E19*
SMART Domains Protein: ENSMUSP00000006749
Gene: ENSMUSG00000006574
AA Change: E19*

DomainStartEndE-ValueType
low complexity region 58 68 N/A INTRINSIC
Pfam:Band_3_cyto 100 342 1.6e-81 PFAM
Pfam:HCO3_cotransp 391 584 5.7e-85 PFAM
Pfam:HCO3_cotransp 575 857 5.6e-118 PFAM
transmembrane domain 875 892 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128405
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145636
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151050
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the anion exchanger (AE) family and is expressed in the erythrocyte plasma membrane, where it functions as a chloride/bicarbonate exchanger involved in carbon dioxide transport from tissues to lungs. The protein comprises two domains that are structurally and functionally distinct. The N-terminal 40kDa domain is located in the cytoplasm and acts as an attachment site for the red cell skeleton by binding ankyrin. The glycosylated C-terminal membrane-associated domain contains 12-14 membrane spanning segments and carries out the stilbene disulphonate-sensitive exchange transport of anions. The cytoplasmic tail at the extreme C-terminus of the membrane domain binds carbonic anhydrase II. The encoded protein associates with the red cell membrane protein glycophorin A and this association promotes the correct folding and translocation of the exchanger. This protein is predominantly dimeric but forms tetramers in the presence of ankyrin. Many mutations in this gene are known in man, and these mutations can lead to two types of disease: destabilization of red cell membrane leading to hereditary spherocytosis, and defective kidney acid secretion leading to distal renal tubular acidosis. Other mutations that do not give rise to disease result in novel blood group antigens, which form the Diego blood group system. Southeast Asian ovalocytosis (SAO, Melanesian ovalocytosis) results from the heterozygous presence of a deletion in the encoded protein and is common in areas where Plasmodium falciparum malaria is endemic. One null mutation in this gene is known, resulting in very severe anemia and nephrocalcinosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for null mutations exhibit retarded growth, severe spherocytosis, hemolytic anemia, lack of erythrocyte glycophorin A, mitotic defects, and high postnatal mortality. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(3) Targeted, other(1) Spontaneous(1) Chemically induced(1)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atxn3 A T 12: 101,903,665 (GRCm39) M180K probably benign Het
Bnip2 G T 9: 69,909,393 (GRCm39) R236L probably null Het
Boc T C 16: 44,312,724 (GRCm39) D582G probably benign Het
Cacul1 T C 19: 60,568,805 (GRCm39) S118G probably benign Het
Ccdc192 T C 18: 57,863,852 (GRCm39) S219P possibly damaging Het
Cpa2 A T 6: 30,554,193 (GRCm39) D271V probably damaging Het
Cubn G A 2: 13,435,683 (GRCm39) T1091M probably damaging Het
Dlgap2 A G 8: 14,881,465 (GRCm39) T846A probably benign Het
Eif5 G T 12: 111,510,042 (GRCm39) A329S probably damaging Het
Fam136b-ps G A 15: 31,276,962 (GRCm39) probably benign Het
Gnrhr A G 5: 86,330,168 (GRCm39) V284A probably benign Het
Grin3a A G 4: 49,844,991 (GRCm39) S31P probably damaging Het
Hectd2 T C 19: 36,592,938 (GRCm39) L701P probably damaging Het
Hook1 C T 4: 95,889,507 (GRCm39) T241I probably benign Het
Kif5a A G 10: 127,084,123 (GRCm39) V52A probably damaging Het
Lasp1 T A 11: 97,697,722 (GRCm39) Y11* probably null Het
Meltf A G 16: 31,703,894 (GRCm39) Y207C probably damaging Het
Mllt3 ACTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCTACTACTACTGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCT ACTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCTACTACTACTGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCT 4: 87,759,504 (GRCm39) probably benign Het
Nek1 A G 8: 61,507,367 (GRCm39) probably null Het
Notch2 C A 3: 98,028,197 (GRCm39) N969K possibly damaging Het
Or4c116 T A 2: 88,942,506 (GRCm39) M117L probably benign Het
Pcnx2 C T 8: 126,617,851 (GRCm39) G135R probably benign Het
Pla2g4f A T 2: 120,138,723 (GRCm39) L242Q probably damaging Het
Plcxd2 T G 16: 45,785,470 (GRCm39) T312P probably damaging Het
Prpf4 G A 4: 62,336,097 (GRCm39) V275I possibly damaging Het
Prpf8 G A 11: 75,386,252 (GRCm39) probably null Het
Pxn T C 5: 115,692,121 (GRCm39) L401P probably damaging Het
Rab44 A T 17: 29,354,754 (GRCm39) probably benign Het
Rfx6 C A 10: 51,601,586 (GRCm39) T669K probably benign Het
Rgs16 A G 1: 153,619,420 (GRCm39) N142S probably damaging Het
Rhobtb1 A G 10: 69,106,146 (GRCm39) E237G possibly damaging Het
Rsbn1 A C 3: 103,835,757 (GRCm39) D265A probably damaging Het
Rufy4 A G 1: 74,171,526 (GRCm39) probably null Het
Tctn1 A G 5: 122,380,731 (GRCm39) S526P probably damaging Het
Tspear A T 10: 77,706,343 (GRCm39) H371L probably benign Het
Vmn1r34 A T 6: 66,614,499 (GRCm39) F80I probably benign Het
Wdr75 G A 1: 45,851,216 (GRCm39) S264N probably damaging Het
Zfp652 A T 11: 95,654,616 (GRCm39) N340Y probably damaging Het
Zp3 A G 5: 136,016,190 (GRCm39) T306A probably benign Het
Other mutations in Slc4a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01303:Slc4a1 APN 11 102,248,790 (GRCm39) missense probably benign 0.09
IGL01845:Slc4a1 APN 11 102,244,729 (GRCm39) missense probably benign 0.01
IGL02166:Slc4a1 APN 11 102,245,159 (GRCm39) missense probably damaging 1.00
IGL02745:Slc4a1 APN 11 102,247,093 (GRCm39) missense probably damaging 1.00
IGL02801:Slc4a1 APN 11 102,249,972 (GRCm39) critical splice acceptor site probably null
Rumor UTSW 11 102,252,048 (GRCm39) nonsense probably null
A5278:Slc4a1 UTSW 11 102,244,641 (GRCm39) splice site probably benign
R0011:Slc4a1 UTSW 11 102,247,936 (GRCm39) missense possibly damaging 0.51
R0193:Slc4a1 UTSW 11 102,243,510 (GRCm39) missense possibly damaging 0.91
R0445:Slc4a1 UTSW 11 102,245,192 (GRCm39) missense probably benign 0.04
R0599:Slc4a1 UTSW 11 102,248,741 (GRCm39) splice site probably benign
R0635:Slc4a1 UTSW 11 102,243,498 (GRCm39) missense possibly damaging 0.78
R1496:Slc4a1 UTSW 11 102,251,997 (GRCm39) missense probably benign
R1816:Slc4a1 UTSW 11 102,242,056 (GRCm39) missense probably damaging 1.00
R1898:Slc4a1 UTSW 11 102,241,133 (GRCm39) missense probably damaging 1.00
R2361:Slc4a1 UTSW 11 102,247,656 (GRCm39) missense probably damaging 1.00
R2381:Slc4a1 UTSW 11 102,250,128 (GRCm39) missense probably benign 0.00
R3806:Slc4a1 UTSW 11 102,248,019 (GRCm39) missense probably benign 0.00
R3857:Slc4a1 UTSW 11 102,247,947 (GRCm39) missense probably benign 0.01
R3858:Slc4a1 UTSW 11 102,247,947 (GRCm39) missense probably benign 0.01
R4585:Slc4a1 UTSW 11 102,252,245 (GRCm39) utr 5 prime probably benign
R4586:Slc4a1 UTSW 11 102,252,245 (GRCm39) utr 5 prime probably benign
R4705:Slc4a1 UTSW 11 102,247,084 (GRCm39) missense possibly damaging 0.89
R4914:Slc4a1 UTSW 11 102,243,279 (GRCm39) missense probably damaging 1.00
R4915:Slc4a1 UTSW 11 102,243,279 (GRCm39) missense probably damaging 1.00
R4916:Slc4a1 UTSW 11 102,243,279 (GRCm39) missense probably damaging 1.00
R4918:Slc4a1 UTSW 11 102,243,279 (GRCm39) missense probably damaging 1.00
R5001:Slc4a1 UTSW 11 102,242,329 (GRCm39) missense probably benign 0.12
R5103:Slc4a1 UTSW 11 102,244,087 (GRCm39) missense possibly damaging 0.65
R5234:Slc4a1 UTSW 11 102,252,209 (GRCm39) missense probably benign 0.03
R5308:Slc4a1 UTSW 11 102,249,903 (GRCm39) missense probably damaging 0.98
R5315:Slc4a1 UTSW 11 102,249,080 (GRCm39) missense possibly damaging 0.77
R5478:Slc4a1 UTSW 11 102,241,140 (GRCm39) missense probably damaging 0.98
R5521:Slc4a1 UTSW 11 102,244,092 (GRCm39) missense probably benign 0.01
R5888:Slc4a1 UTSW 11 102,247,351 (GRCm39) missense probably damaging 0.98
R6011:Slc4a1 UTSW 11 102,243,357 (GRCm39) missense probably damaging 1.00
R6547:Slc4a1 UTSW 11 102,247,561 (GRCm39) missense probably damaging 0.99
R6717:Slc4a1 UTSW 11 102,245,249 (GRCm39) missense probably damaging 0.99
R7051:Slc4a1 UTSW 11 102,247,084 (GRCm39) missense probably benign 0.12
R7103:Slc4a1 UTSW 11 102,244,693 (GRCm39) missense probably damaging 0.97
R7315:Slc4a1 UTSW 11 102,247,310 (GRCm39) missense probably damaging 1.00
R7331:Slc4a1 UTSW 11 102,252,245 (GRCm39) start gained probably benign
R7582:Slc4a1 UTSW 11 102,243,403 (GRCm39) missense probably damaging 0.99
R8560:Slc4a1 UTSW 11 102,244,083 (GRCm39) missense possibly damaging 0.94
R9036:Slc4a1 UTSW 11 102,243,279 (GRCm39) missense probably damaging 1.00
R9274:Slc4a1 UTSW 11 102,242,047 (GRCm39) missense probably benign 0.00
R9502:Slc4a1 UTSW 11 102,247,674 (GRCm39) missense probably damaging 0.97
R9568:Slc4a1 UTSW 11 102,247,680 (GRCm39) missense probably damaging 1.00
R9585:Slc4a1 UTSW 11 102,247,915 (GRCm39) missense probably benign 0.08
R9651:Slc4a1 UTSW 11 102,242,256 (GRCm39) missense probably damaging 1.00
RF006:Slc4a1 UTSW 11 102,247,542 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGTTTATCCTTCAATCAGCCAGG -3'
(R):5'- ACACTGAGGACGGCATCATG -3'

Sequencing Primer
(F):5'- CAATCAGCCAGGATTGTGGG -3'
(R):5'- ACGGCATCATGGGGGAC -3'
Posted On 2018-06-22