Incidental Mutation 'R6604:Gpbp1l1'
ID525525
Institutional Source Beutler Lab
Gene Symbol Gpbp1l1
Ensembl Gene ENSMUSG00000034042
Gene NameGC-rich promoter binding protein 1-like 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6604 (G1)
Quality Score140.008
Status Not validated
Chromosome4
Chromosomal Location116557658-116593882 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 116573505 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 58 (P58S)
Ref Sequence ENSEMBL: ENSMUSP00000102083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030460] [ENSMUST00000106475]
Predicted Effect probably benign
Transcript: ENSMUST00000030460
AA Change: P58S

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000030460
Gene: ENSMUSG00000034042
AA Change: P58S

DomainStartEndE-ValueType
low complexity region 204 219 N/A INTRINSIC
low complexity region 237 251 N/A INTRINSIC
low complexity region 289 320 N/A INTRINSIC
Pfam:Vasculin 376 470 5.1e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106475
AA Change: P58S

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000102083
Gene: ENSMUSG00000034042
AA Change: P58S

DomainStartEndE-ValueType
low complexity region 204 219 N/A INTRINSIC
low complexity region 237 251 N/A INTRINSIC
low complexity region 289 320 N/A INTRINSIC
Pfam:Vasculin 377 470 1.3e-44 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik A G 15: 37,439,579 probably benign Het
Abca13 T G 11: 9,378,384 F3486V probably damaging Het
Adcy9 A G 16: 4,304,407 L830P probably damaging Het
Aurkb T A 11: 69,048,562 L157* probably null Het
Bbs10 T G 10: 111,301,104 L693V possibly damaging Het
Dna2 G T 10: 62,967,743 probably null Het
Ext1 A G 15: 53,083,159 F550L probably damaging Het
Gm11639 T A 11: 104,698,946 L123* probably null Het
Gm13101 T C 4: 143,965,997 R145G probably benign Het
Gm5129 A G 5: 29,735,767 probably benign Het
Golm1 A G 13: 59,638,383 Y332H probably damaging Het
Grk4 A T 5: 34,719,864 D301V probably damaging Het
Haus1 T C 18: 77,764,097 E106G probably damaging Het
Hpd T C 5: 123,180,901 probably null Het
Kcnj6 C A 16: 94,762,645 E313D probably damaging Het
Lmna A G 3: 88,488,282 V57A probably damaging Het
Lrrtm1 T C 6: 77,244,238 F226S possibly damaging Het
Otogl T C 10: 107,822,034 probably null Het
Pgr A C 9: 8,946,866 T703P possibly damaging Het
Ppig T C 2: 69,741,581 S215P unknown Het
Rasgrp3 A C 17: 75,503,115 N270T probably benign Het
Rp1 C A 1: 4,019,128 K1305N unknown Het
Shc1 A G 3: 89,421,879 Y10C probably damaging Het
Slc12a1 G T 2: 125,184,815 D457Y probably damaging Het
Sncaip A G 18: 52,905,846 Q544R possibly damaging Het
Socs5 T C 17: 87,135,125 Y498H probably damaging Het
Szt2 T C 4: 118,385,474 D1472G probably benign Het
Tmem163 A G 1: 127,491,610 M286T possibly damaging Het
Tmem236 A G 2: 14,174,701 T38A probably benign Het
Vmn2r29 A T 7: 7,231,859 V676E probably damaging Het
Vps13d A G 4: 145,181,124 V56A probably damaging Het
Xirp2 T C 2: 67,509,845 I810T possibly damaging Het
Zfp958 T C 8: 4,628,245 L90P probably damaging Het
Other mutations in Gpbp1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00926:Gpbp1l1 APN 4 116587513 critical splice donor site probably null
IGL03342:Gpbp1l1 APN 4 116574543 missense probably benign
R0534:Gpbp1l1 UTSW 4 116591268 missense probably damaging 1.00
R0964:Gpbp1l1 UTSW 4 116581239 splice site probably benign
R1136:Gpbp1l1 UTSW 4 116592918 missense probably damaging 1.00
R1169:Gpbp1l1 UTSW 4 116574366 missense possibly damaging 0.53
R3975:Gpbp1l1 UTSW 4 116570985 critical splice donor site probably null
R4296:Gpbp1l1 UTSW 4 116587459 missense possibly damaging 0.80
R4676:Gpbp1l1 UTSW 4 116590265 missense probably damaging 1.00
R4870:Gpbp1l1 UTSW 4 116573517 missense probably benign
R5086:Gpbp1l1 UTSW 4 116588592 missense probably benign 0.04
R5931:Gpbp1l1 UTSW 4 116590260 missense probably benign 0.00
R6486:Gpbp1l1 UTSW 4 116581375 missense probably damaging 0.99
R6973:Gpbp1l1 UTSW 4 116581282 missense possibly damaging 0.53
R7031:Gpbp1l1 UTSW 4 116592848 missense probably damaging 1.00
R7230:Gpbp1l1 UTSW 4 116588610 missense probably damaging 0.99
R7286:Gpbp1l1 UTSW 4 116590245 missense probably benign 0.02
R7368:Gpbp1l1 UTSW 4 116573458 missense probably benign 0.04
R7791:Gpbp1l1 UTSW 4 116574420 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCCAATAAGCTACTGAAGG -3'
(R):5'- CCAGTCTGAGTTTAGTGTAAATAGCAC -3'

Sequencing Primer
(F):5'- CTGAAGGAAACTGAATCTTTTCCTC -3'
(R):5'- CTGGTCTACAAGTGAGTTCCAGGAC -3'
Posted On2018-06-22