Incidental Mutation 'R6668:Sars2'
List |< first << previous [record 32 of 40] next >> last >|
ID527063
Institutional Source Beutler Lab
Gene Symbol Sars2
Ensembl Gene ENSMUSG00000070699
Gene Nameseryl-aminoacyl-tRNA synthetase 2
Synonyms2410015F05Rik, D7Ertd353e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.873) question?
Stock #R6668 (G1)
Quality Score198.009
Status Validated
Chromosome7
Chromosomal Location28741992-28753871 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 28747004 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 194 (E194K)
Ref Sequence ENSEMBL: ENSMUSP00000092216 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094632] [ENSMUST00000207877]
Predicted Effect probably benign
Transcript: ENSMUST00000094632
AA Change: E194K

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000092216
Gene: ENSMUSG00000070699
AA Change: E194K

DomainStartEndE-ValueType
Pfam:Seryl_tRNA_N 58 174 3.8e-8 PFAM
Pfam:tRNA-synt_2b 284 468 5.2e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207877
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207897
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the mitochondrial seryl-tRNA synthethase precursor, a member of the class II tRNA synthetase family. The mature enzyme catalyzes the ligation of Serine to tRNA(Ser) and participates in the biosynthesis of selenocysteinyl-tRNA(sec) in mitochondria. The enzyme contains an N-terminal tRNA binding domain and a core catalytic domain. It functions in a homodimeric form, which is stabilized by tRNA binding. This gene is regulated by a bidirectional promoter that also controls the expression of mitochondrial ribosomal protein S12. Both genes are within the critical interval for the autosomal dominant deafness locus DFNA4 and might be linked to this disease. Multiple transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aanat G T 11: 116,596,042 probably benign Het
Adam26b A T 8: 43,520,690 V425D possibly damaging Het
Ahctf1 A G 1: 179,752,407 S2077P probably benign Het
Amacr A G 15: 10,983,382 T93A probably benign Het
Arsb T A 13: 93,794,220 probably null Het
Bcas3 G A 11: 85,801,851 R354Q probably damaging Het
Chia1 C T 3: 106,130,948 L387F probably damaging Het
Cyp24a1 A T 2: 170,485,885 probably null Het
Dennd4a G A 9: 64,886,965 G689S probably damaging Het
Elovl4 G A 9: 83,805,986 A18V probably benign Het
Fam135a A T 1: 24,028,848 V80E probably damaging Het
Fmo2 T A 1: 162,877,048 T430S probably benign Het
Fpgs T C 2: 32,687,606 I213V probably benign Het
Gm10134 A T 2: 28,506,251 R53* probably null Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Ift172 T C 5: 31,255,339 N1524S probably benign Het
Kif1b G A 4: 149,213,407 S1104F probably benign Het
Map3k21 T C 8: 125,926,113 V326A possibly damaging Het
Mlst8 A G 17: 24,477,479 probably null Het
Muc16 A T 9: 18,640,385 S4871T probably benign Het
Myo1d A G 11: 80,583,875 probably benign Het
Ndufa3 A G 7: 3,619,466 Y41C probably damaging Het
Nfkbid T A 7: 30,424,441 L142Q probably benign Het
Olfr885 T A 9: 38,061,770 M150K possibly damaging Het
Peg10 T A 6: 4,754,502 D94E probably benign Het
Phactr3 A T 2: 178,332,864 I492F probably damaging Het
Plxna2 T C 1: 194,810,088 V1751A possibly damaging Het
Prss16 T C 13: 22,006,748 E238G probably null Het
Rad51ap2 T C 12: 11,457,646 V523A probably benign Het
Rbm33 T A 5: 28,342,500 S223T probably benign Het
Ryk T A 9: 102,869,276 F137I possibly damaging Het
Spata2l T C 8: 123,233,428 D374G probably damaging Het
Tenm2 A G 11: 36,046,765 probably null Het
Ubr4 A G 4: 139,465,341 K1097E probably damaging Het
Ulk4 A T 9: 121,188,342 V690E probably damaging Het
Usp34 A G 11: 23,460,659 N2703S probably damaging Het
Zfp273 C G 13: 67,825,124 L124V probably damaging Het
Zfp608 A G 18: 54,898,019 S950P probably damaging Het
Zfp994 A T 17: 22,201,100 H289Q probably damaging Het
Other mutations in Sars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00907:Sars2 APN 7 28753423 unclassified probably benign
IGL01376:Sars2 APN 7 28749883 missense probably damaging 1.00
IGL01633:Sars2 APN 7 28747549 missense probably benign 0.02
IGL02121:Sars2 APN 7 28752525 unclassified probably benign
IGL02488:Sars2 APN 7 28742160 nonsense probably null
IGL03062:Sars2 APN 7 28746781 missense possibly damaging 0.89
R1601:Sars2 UTSW 7 28748971 missense probably benign 0.26
R1857:Sars2 UTSW 7 28750012 missense probably benign 0.00
R1859:Sars2 UTSW 7 28744312 missense probably damaging 0.99
R2193:Sars2 UTSW 7 28748997 missense probably damaging 0.96
R2204:Sars2 UTSW 7 28749674 missense possibly damaging 0.95
R4452:Sars2 UTSW 7 28750093 missense probably benign 0.08
R4514:Sars2 UTSW 7 28742284 critical splice donor site probably null
R4921:Sars2 UTSW 7 28752438 missense possibly damaging 0.81
R5121:Sars2 UTSW 7 28747908 missense probably damaging 0.99
R5434:Sars2 UTSW 7 28750291 missense probably null 1.00
R5849:Sars2 UTSW 7 28744258 missense possibly damaging 0.92
R7123:Sars2 UTSW 7 28753441 missense probably benign 0.40
R7205:Sars2 UTSW 7 28744308 missense probably benign
R7677:Sars2 UTSW 7 28746751 missense probably benign 0.07
R7902:Sars2 UTSW 7 28742203 missense probably benign 0.29
R7985:Sars2 UTSW 7 28742203 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- CCAATATCAGGGCCTGCGG -3'
(R):5'- GGCTGCCCAGTGAAGGAA -3'

Sequencing Primer
(F):5'- GAGATCCGGAAGCAGCTCAC -3'
(R):5'- AGGGCAAGGAGTCGCAGC -3'
Posted On2018-07-23