Incidental Mutation 'R6705:Lrrc55'
ID528884
Institutional Source Beutler Lab
Gene Symbol Lrrc55
Ensembl Gene ENSMUSG00000075224
Gene Nameleucine rich repeat containing 55
SynonymsLOC241528, A330097E02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6705 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location85162334-85196699 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85196355 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 108 (D108E)
Ref Sequence ENSEMBL: ENSMUSP00000107228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099930] [ENSMUST00000111601]
Predicted Effect probably benign
Transcript: ENSMUST00000099930
AA Change: D108E

PolyPhen 2 Score 0.330 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000097514
Gene: ENSMUSG00000075224
AA Change: D108E

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
LRRNT 50 82 2.57e-7 SMART
LRR 103 124 3.29e-1 SMART
LRR 126 148 4.7e0 SMART
LRR 150 173 2.47e2 SMART
LRR 174 197 2.4e1 SMART
LRRCT 209 263 6.85e-9 SMART
transmembrane domain 272 294 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111601
AA Change: D108E

PolyPhen 2 Score 0.330 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000107228
Gene: ENSMUSG00000075224
AA Change: D108E

DomainStartEndE-ValueType
signal peptide 1 47 N/A INTRINSIC
LRRNT 50 82 2.57e-7 SMART
LRR 103 124 3.29e-1 SMART
LRR 126 148 4.7e0 SMART
LRR 150 173 2.47e2 SMART
LRR 174 197 2.4e1 SMART
LRRCT 209 263 6.85e-9 SMART
transmembrane domain 272 294 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126401
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139377
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 G A 19: 57,215,821 T46I probably benign Het
Afdn G A 17: 13,888,021 V1269I probably benign Het
Aldh5a1 A T 13: 24,912,270 N448K probably damaging Het
Cant1 G T 11: 118,407,872 T355K probably damaging Het
Comp C A 8: 70,376,737 N321K probably damaging Het
Ctgf T A 10: 24,595,955 L25Q probably damaging Het
D1Pas1 G T 1: 186,968,379 E168D probably benign Het
Ddx23 G A 15: 98,652,968 R111* probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Erlin2 T A 8: 27,036,440 L276Q probably damaging Het
Etaa1 T C 11: 17,945,639 N826S probably benign Het
Fam168b A T 1: 34,828,783 N45K probably damaging Het
Gas2l2 G A 11: 83,422,636 R617* probably null Het
Gtf3c2 C A 5: 31,166,008 C533F possibly damaging Het
Hdac5 T C 11: 102,201,236 T676A probably damaging Het
Helb A G 10: 120,089,811 probably null Het
Igkv3-7 A T 6: 70,608,020 S95C probably benign Het
Kdm3b A G 18: 34,819,873 I899V probably damaging Het
Lgr5 G A 10: 115,587,288 S69F probably damaging Het
Mphosph9 T C 5: 124,290,964 N667S possibly damaging Het
Myf6 C T 10: 107,493,829 V198M possibly damaging Het
Nav2 T C 7: 49,551,916 S1413P probably damaging Het
Nfe2l1 A C 11: 96,827,625 V28G probably damaging Het
Nup210 G T 6: 91,087,960 T186K possibly damaging Het
Olfr46 T A 7: 140,610,784 M206K probably damaging Het
Olfr786 G A 10: 129,437,072 D87N probably benign Het
Olfr874 T A 9: 37,746,734 I200N possibly damaging Het
Olfr878 T A 9: 37,918,784 N42K probably damaging Het
Ppfia1 G A 7: 144,519,174 T301M possibly damaging Het
Ppp1r14c A T 10: 3,366,890 Y75F probably damaging Het
Ppp1r3g C A 13: 35,968,897 A100E probably benign Het
Rictor A G 15: 6,794,012 T1557A probably benign Het
Shc1 C T 3: 89,422,959 R67* probably null Het
Skint10 A T 4: 112,773,104 probably benign Het
Slk A G 19: 47,609,059 N102S probably benign Het
Tbc1d5 T C 17: 51,025,175 probably benign Het
Tiam2 G A 17: 3,518,243 V1555I probably benign Het
Vmn1r174 C A 7: 23,754,426 S172R probably benign Het
Vps39 A T 2: 120,320,676 N823K probably benign Het
Wdr27 A T 17: 14,934,590 Y22N probably damaging Het
Xrn2 A G 2: 147,036,662 probably null Het
Zbp1 A T 2: 173,213,887 C161* probably null Het
Zfp236 T A 18: 82,633,737 E821V probably damaging Het
Other mutations in Lrrc55
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Lrrc55 APN 2 85196215 missense possibly damaging 0.53
IGL01646:Lrrc55 APN 2 85191989 missense probably damaging 0.99
R0149:Lrrc55 UTSW 2 85196245 missense probably damaging 0.98
R0361:Lrrc55 UTSW 2 85196245 missense probably damaging 0.98
R0491:Lrrc55 UTSW 2 85191920 missense probably damaging 1.00
R4223:Lrrc55 UTSW 2 85196116 missense possibly damaging 0.82
R4654:Lrrc55 UTSW 2 85196536 missense possibly damaging 0.82
R4746:Lrrc55 UTSW 2 85196170 missense probably damaging 1.00
R5756:Lrrc55 UTSW 2 85196383 missense probably benign 0.34
R6329:Lrrc55 UTSW 2 85196309 missense probably benign 0.28
R6985:Lrrc55 UTSW 2 85191930 missense probably benign 0.27
R7229:Lrrc55 UTSW 2 85196440 missense probably damaging 1.00
R8132:Lrrc55 UTSW 2 85191915 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAGGTCCAGGTCTCTGAGATG -3'
(R):5'- AGTTGCCCAGTCCTTTGTACATG -3'

Sequencing Primer
(F):5'- TCCAGGTCTCTGAGATGCACAAG -3'
(R):5'- GTCCTTTGTACATGTCGTAACCAAG -3'
Posted On2018-07-24