Incidental Mutation 'R6705:Ppp1r3g'
ID528915
Institutional Source Beutler Lab
Gene Symbol Ppp1r3g
Ensembl Gene ENSMUSG00000050423
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 3G
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R6705 (G1)
Quality Score112.008
Status Validated
Chromosome13
Chromosomal Location35958839-35970388 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 35968897 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 100 (A100E)
Ref Sequence ENSEMBL: ENSMUSP00000153702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000132661] [ENSMUST00000225537]
Predicted Effect probably benign
Transcript: ENSMUST00000132661
AA Change: A100E

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000122712
Gene: ENSMUSG00000050423
AA Change: A100E

DomainStartEndE-ValueType
low complexity region 88 102 N/A INTRINSIC
Pfam:CBM_21 202 339 9.2e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172766
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223592
Predicted Effect probably benign
Transcript: ENSMUST00000225537
AA Change: A100E

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.7%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 G A 19: 57,215,821 T46I probably benign Het
Afdn G A 17: 13,888,021 V1269I probably benign Het
Aldh5a1 A T 13: 24,912,270 N448K probably damaging Het
Cant1 G T 11: 118,407,872 T355K probably damaging Het
Comp C A 8: 70,376,737 N321K probably damaging Het
Ctgf T A 10: 24,595,955 L25Q probably damaging Het
D1Pas1 G T 1: 186,968,379 E168D probably benign Het
Ddx23 G A 15: 98,652,968 R111* probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Erlin2 T A 8: 27,036,440 L276Q probably damaging Het
Etaa1 T C 11: 17,945,639 N826S probably benign Het
Fam168b A T 1: 34,828,783 N45K probably damaging Het
Gas2l2 G A 11: 83,422,636 R617* probably null Het
Gtf3c2 C A 5: 31,166,008 C533F possibly damaging Het
Hdac5 T C 11: 102,201,236 T676A probably damaging Het
Helb A G 10: 120,089,811 probably null Het
Igkv3-7 A T 6: 70,608,020 S95C probably benign Het
Kdm3b A G 18: 34,819,873 I899V probably damaging Het
Lgr5 G A 10: 115,587,288 S69F probably damaging Het
Lrrc55 A T 2: 85,196,355 D108E probably benign Het
Mphosph9 T C 5: 124,290,964 N667S possibly damaging Het
Myf6 C T 10: 107,493,829 V198M possibly damaging Het
Nav2 T C 7: 49,551,916 S1413P probably damaging Het
Nfe2l1 A C 11: 96,827,625 V28G probably damaging Het
Nup210 G T 6: 91,087,960 T186K possibly damaging Het
Olfr46 T A 7: 140,610,784 M206K probably damaging Het
Olfr786 G A 10: 129,437,072 D87N probably benign Het
Olfr874 T A 9: 37,746,734 I200N possibly damaging Het
Olfr878 T A 9: 37,918,784 N42K probably damaging Het
Ppfia1 G A 7: 144,519,174 T301M possibly damaging Het
Ppp1r14c A T 10: 3,366,890 Y75F probably damaging Het
Rictor A G 15: 6,794,012 T1557A probably benign Het
Shc1 C T 3: 89,422,959 R67* probably null Het
Skint10 A T 4: 112,773,104 probably benign Het
Slk A G 19: 47,609,059 N102S probably benign Het
Tbc1d5 T C 17: 51,025,175 probably benign Het
Tiam2 G A 17: 3,518,243 V1555I probably benign Het
Vmn1r174 C A 7: 23,754,426 S172R probably benign Het
Vps39 A T 2: 120,320,676 N823K probably benign Het
Wdr27 A T 17: 14,934,590 Y22N probably damaging Het
Xrn2 A G 2: 147,036,662 probably null Het
Zbp1 A T 2: 173,213,887 C161* probably null Het
Zfp236 T A 18: 82,633,737 E821V probably damaging Het
Other mutations in Ppp1r3g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01946:Ppp1r3g APN 13 35968995 missense possibly damaging 0.90
IGL02890:Ppp1r3g APN 13 35969331 missense probably damaging 0.98
R0413:Ppp1r3g UTSW 13 35969348 missense probably damaging 1.00
R1065:Ppp1r3g UTSW 13 35969435 missense probably benign 0.07
R4497:Ppp1r3g UTSW 13 35969620 missense probably benign 0.15
R5677:Ppp1r3g UTSW 13 35969262 missense probably damaging 1.00
X0027:Ppp1r3g UTSW 13 35969223 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTCCGGAGACCCTCAATC -3'
(R):5'- GAGAGGATCAGGCATCGTTG -3'

Sequencing Primer
(F):5'- AGAGTGGCACCTCTGAGAC -3'
(R):5'- ATCGTTGCCACTGCCAG -3'
Posted On2018-07-24