Mutagenetix > Incidental Mutation

Incidental Mutation 'R6708:Mrpl21'

529027

Institutional Source

Beutler Lab

Gene Symbol

Mrpl21

Ensembl Gene

ENSMUSG00000024829

Gene Name

mitochondrial ribosomal protein L21

Synonyms

MMRRC Submission

044826-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.950) question?

Stock #

R6708 (G1)

Quality Score

191.009

Status

Not validated

Chromosome

Chromosomal Location

3332997-3342837 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 3336890 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 87 (V87A)

Ref Sequence

ENSEMBL: ENSMUSP00000025745 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025743] [ENSMUST00000025745] [ENSMUST00000025751] [ENSMUST00000119292] [ENSMUST00000141610] [ENSMUST00000154537]

AlphaFold

Q9D1N9

Predicted Effect

probably damaging
Transcript: ENSMUST00000025743
AA Change: V87A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000025743
Gene: ENSMUSG00000024829
AA Change: V87A

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
Pfam:Ribosomal_L21p	99	197	7.5e-25	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000025745
AA Change: V87A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000025745
Gene: ENSMUSG00000024829
AA Change: V87A

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
Pfam:Ribosomal_L21p	99	192	6e-22	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000025751

SMART Domains

Protein: ENSMUSP00000025751
Gene: ENSMUSG00000024831

Domain	Start	End	E-Value	Type
DEXDc	187	446	8.99e-6	SMART
AAA	205	374	9.08e-6	SMART
low complexity region	598	609	N/A	INTRINSIC
R3H	704	783	1.2e-22	SMART
low complexity region	784	813	N/A	INTRINSIC
low complexity region	858	869	N/A	INTRINSIC
ZnF_AN1	895	935	5.65e-13	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000119292

SMART Domains

Protein: ENSMUSP00000113438
Gene: ENSMUSG00000024831

Domain	Start	End	E-Value	Type
DEXDc	187	446	8.99e-6	SMART
AAA	205	374	9.08e-6	SMART
low complexity region	598	609	N/A	INTRINSIC
R3H	704	783	1.2e-22	SMART
low complexity region	784	813	N/A	INTRINSIC
low complexity region	858	869	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139844

Predicted Effect

probably benign
Transcript: ENSMUST00000141610

SMART Domains

Protein: ENSMUSP00000120330
Gene: ENSMUSG00000024829

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
PDB:4CE4\|V	14	53	1e-5	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000154537

SMART Domains

Protein: ENSMUSP00000122827
Gene: ENSMUSG00000024831

Domain	Start	End	E-Value	Type
PDB:4B3F\|X	3	160	2e-80	PDB
low complexity region	230	244	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154785

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155870

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185105

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. Multiple transcript variants encoding different isoforms were identified through sequence analysis although some may be subject to nonsense-mediated decay (NMD). [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam20	T	C	8: 41,249,531 (GRCm39)	L547P	probably damaging	Het
Atp8b5	T	G	4: 43,334,249 (GRCm39)	H338Q	probably benign	Het
Btbd3	A	G	2: 138,125,491 (GRCm39)	E225G	possibly damaging	Het
Cd163	A	G	6: 124,286,167 (GRCm39)	H239R	probably damaging	Het
Cdh15	T	C	8: 123,590,294 (GRCm39)	I409T	probably benign	Het
Cep55	T	A	19: 38,048,709 (GRCm39)	S122T	probably benign	Het
Col5a3	G	A	9: 20,686,331 (GRCm39)	P1382L	unknown	Het
Ehmt2	A	T	17: 35,118,875 (GRCm39)	K186*	probably null	Het
Elavl2	A	T	4: 91,141,634 (GRCm39)	I295N	probably damaging	Het
Elf5	A	G	2: 103,279,334 (GRCm39)	D185G	probably damaging	Het
Emx1	A	G	6: 85,171,122 (GRCm39)	E175G	probably damaging	Het
Fan1	T	G	7: 64,022,554 (GRCm39)	N233T	probably benign	Het
Frem2	T	A	3: 53,492,922 (GRCm39)	I1865F	probably benign	Het
Kcnu1	A	G	8: 26,427,739 (GRCm39)	D352G	probably benign	Het
Klhdc1	A	T	12: 69,306,304 (GRCm39)	H247L	possibly damaging	Het
L3mbtl4	A	T	17: 68,937,253 (GRCm39)	T425S	probably benign	Het
Or4d11	A	T	19: 12,014,103 (GRCm39)	M1K	probably null	Het
Or5ac21	T	A	16: 59,124,416 (GRCm39)	L301Q	probably damaging	Het
Or6c215	G	T	10: 129,637,689 (GRCm39)	A235D	probably damaging	Het
Orc4	A	T	2: 48,827,505 (GRCm39)	H29Q	probably benign	Het
Pcnx2	C	T	8: 126,587,692 (GRCm39)		probably null	Het
Pogk	A	G	1: 166,231,078 (GRCm39)	V83A	probably damaging	Het
Synm	T	C	7: 67,382,994 (GRCm39)	E1556G	possibly damaging	Het
Tmem109	C	A	19: 10,849,395 (GRCm39)	L153F	probably damaging	Het
Ttc8	A	G	12: 98,909,791 (GRCm39)	T74A	probably damaging	Het
Zfp180	A	T	7: 23,805,521 (GRCm39)	T647S	probably damaging	Het

Other mutations in Mrpl21

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03184:Mrpl21	APN	19	3,342,529 (GRCm39)	unclassified	probably benign
R0079:Mrpl21	UTSW	19	3,334,807 (GRCm39)	missense	possibly damaging	0.50
R0410:Mrpl21	UTSW	19	3,334,792 (GRCm39)	missense	possibly damaging	0.83
R0449:Mrpl21	UTSW	19	3,342,459 (GRCm39)	unclassified	probably benign
R1458:Mrpl21	UTSW	19	3,334,808 (GRCm39)	missense	possibly damaging	0.75
R4229:Mrpl21	UTSW	19	3,336,901 (GRCm39)	missense	probably damaging	0.98
R5269:Mrpl21	UTSW	19	3,337,012 (GRCm39)	missense	probably damaging	1.00
R5327:Mrpl21	UTSW	19	3,337,009 (GRCm39)	splice site	probably null
R6148:Mrpl21	UTSW	19	3,333,084 (GRCm39)	missense	probably benign	0.00
R7219:Mrpl21	UTSW	19	3,336,998 (GRCm39)	missense	probably benign	0.02
R7840:Mrpl21	UTSW	19	3,337,752 (GRCm39)	missense	probably damaging	1.00
R8377:Mrpl21	UTSW	19	3,342,487 (GRCm39)	missense	unknown
R9355:Mrpl21	UTSW	19	3,336,937 (GRCm39)	missense	probably damaging	1.00
R9476:Mrpl21	UTSW	19	3,337,704 (GRCm39)	missense	probably damaging	1.00
R9530:Mrpl21	UTSW	19	3,340,998 (GRCm39)	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- AACAGGATGAGGGTTCTGC -3'
(R):5'- TGAGAAAACCCTCAGCCATG -3'

Sequencing Primer
(F):5'- TGCTCCAGAACTGCAGAAG -3'
(R):5'- ATGCTCACTAGGTGCCAGAGTC -3'

Posted On

2018-07-24