Incidental Mutation 'R6708:Mrpl21'
ID529027
Institutional Source Beutler Lab
Gene Symbol Mrpl21
Ensembl Gene ENSMUSG00000024829
Gene Namemitochondrial ribosomal protein L21
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R6708 (G1)
Quality Score191.009
Status Not validated
Chromosome19
Chromosomal Location3282901-3292837 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3286890 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 87 (V87A)
Ref Sequence ENSEMBL: ENSMUSP00000025745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025743] [ENSMUST00000025745] [ENSMUST00000025751] [ENSMUST00000119292] [ENSMUST00000141610] [ENSMUST00000154537]
Predicted Effect probably damaging
Transcript: ENSMUST00000025743
AA Change: V87A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025743
Gene: ENSMUSG00000024829
AA Change: V87A

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Ribosomal_L21p 99 197 7.5e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000025745
AA Change: V87A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025745
Gene: ENSMUSG00000024829
AA Change: V87A

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Ribosomal_L21p 99 192 6e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025751
SMART Domains Protein: ENSMUSP00000025751
Gene: ENSMUSG00000024831

DomainStartEndE-ValueType
DEXDc 187 446 8.99e-6 SMART
AAA 205 374 9.08e-6 SMART
low complexity region 598 609 N/A INTRINSIC
R3H 704 783 1.2e-22 SMART
low complexity region 784 813 N/A INTRINSIC
low complexity region 858 869 N/A INTRINSIC
ZnF_AN1 895 935 5.65e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119292
SMART Domains Protein: ENSMUSP00000113438
Gene: ENSMUSG00000024831

DomainStartEndE-ValueType
DEXDc 187 446 8.99e-6 SMART
AAA 205 374 9.08e-6 SMART
low complexity region 598 609 N/A INTRINSIC
R3H 704 783 1.2e-22 SMART
low complexity region 784 813 N/A INTRINSIC
low complexity region 858 869 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139844
Predicted Effect probably benign
Transcript: ENSMUST00000141610
SMART Domains Protein: ENSMUSP00000120330
Gene: ENSMUSG00000024829

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
PDB:4CE4|V 14 53 1e-5 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000154537
SMART Domains Protein: ENSMUSP00000122827
Gene: ENSMUSG00000024831

DomainStartEndE-ValueType
PDB:4B3F|X 3 160 2e-80 PDB
low complexity region 230 244 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154785
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155870
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185105
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. Multiple transcript variants encoding different isoforms were identified through sequence analysis although some may be subject to nonsense-mediated decay (NMD). [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam20 T C 8: 40,796,494 L547P probably damaging Het
Atp8b5 T G 4: 43,334,249 H338Q probably benign Het
Btbd3 A G 2: 138,283,571 E225G possibly damaging Het
Cd163 A G 6: 124,309,208 H239R probably damaging Het
Cdh15 T C 8: 122,863,555 I409T probably benign Het
Cep55 T A 19: 38,060,261 S122T probably benign Het
Col5a3 G A 9: 20,775,035 P1382L unknown Het
Ehmt2 A T 17: 34,899,899 K186* probably null Het
Elavl2 A T 4: 91,253,397 I295N probably damaging Het
Elf5 A G 2: 103,448,989 D185G probably damaging Het
Emx1 A G 6: 85,194,140 E175G probably damaging Het
Fan1 T G 7: 64,372,806 N233T probably benign Het
Frem2 T A 3: 53,585,501 I1865F probably benign Het
Kcnu1 A G 8: 25,937,711 D352G probably benign Het
Klhdc1 A T 12: 69,259,530 H247L possibly damaging Het
L3mbtl4 A T 17: 68,630,258 T425S probably benign Het
Olfr1423 A T 19: 12,036,739 M1K probably null Het
Olfr203 T A 16: 59,304,053 L301Q probably damaging Het
Olfr811 G T 10: 129,801,820 A235D probably damaging Het
Orc4 A T 2: 48,937,493 H29Q probably benign Het
Pcnx2 C T 8: 125,860,953 probably null Het
Pogk A G 1: 166,403,509 V83A probably damaging Het
Synm T C 7: 67,733,246 E1556G possibly damaging Het
Tmem109 C A 19: 10,872,031 L153F probably damaging Het
Ttc8 A G 12: 98,943,532 T74A probably damaging Het
Zfp180 A T 7: 24,106,096 T647S probably damaging Het
Other mutations in Mrpl21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03184:Mrpl21 APN 19 3292529 unclassified probably benign
R0079:Mrpl21 UTSW 19 3284807 missense possibly damaging 0.50
R0410:Mrpl21 UTSW 19 3284792 missense possibly damaging 0.83
R0449:Mrpl21 UTSW 19 3292459 unclassified probably benign
R1458:Mrpl21 UTSW 19 3284808 missense possibly damaging 0.75
R4229:Mrpl21 UTSW 19 3286901 missense probably damaging 0.98
R5269:Mrpl21 UTSW 19 3287012 missense probably damaging 1.00
R5327:Mrpl21 UTSW 19 3287009 splice site probably null
R6148:Mrpl21 UTSW 19 3283084 missense probably benign 0.00
R7219:Mrpl21 UTSW 19 3286998 missense probably benign 0.02
R7840:Mrpl21 UTSW 19 3287752 missense probably damaging 1.00
R8377:Mrpl21 UTSW 19 3292487 missense unknown
Predicted Primers PCR Primer
(F):5'- AACAGGATGAGGGTTCTGC -3'
(R):5'- TGAGAAAACCCTCAGCCATG -3'

Sequencing Primer
(F):5'- TGCTCCAGAACTGCAGAAG -3'
(R):5'- ATGCTCACTAGGTGCCAGAGTC -3'
Posted On2018-07-24