Incidental Mutation 'R6729:AI182371'
ID529964
Institutional Source Beutler Lab
Gene Symbol AI182371
Ensembl Gene ENSMUSG00000035875
Gene Nameexpressed sequence AI182371
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_178885; MGI: 2138853

Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R6729 (G1)
Quality Score141.008
Status Validated
Chromosome2
Chromosomal Location35081861-35101543 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to T at 35084705 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045776] [ENSMUST00000134940] [ENSMUST00000226375] [ENSMUST00000226631] [ENSMUST00000226972]
Predicted Effect unknown
Transcript: ENSMUST00000045776
AA Change: H345N
SMART Domains Protein: ENSMUSP00000037754
Gene: ENSMUSG00000035875
AA Change: H345N

DomainStartEndE-ValueType
Pfam:A2M_N 133 227 4.7e-19 PFAM
ANATO 284 318 1.97e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134940
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154817
Predicted Effect probably benign
Transcript: ENSMUST00000226375
Predicted Effect probably benign
Transcript: ENSMUST00000226631
Predicted Effect probably benign
Transcript: ENSMUST00000226972
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 100% (34/34)
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,188,601 probably null Het
Acad12 A T 5: 121,607,935 H230Q probably damaging Het
Ank3 T C 10: 69,808,925 V73A probably damaging Het
Apbb1 A T 7: 105,565,381 M28K probably damaging Het
Atp6v1f A G 6: 29,467,965 D50G probably benign Het
Cdkal1 G A 13: 29,474,695 T356M probably damaging Het
Clca1 A G 3: 145,005,966 I756T probably damaging Het
Cyp17a1 A G 19: 46,670,581 V207A probably benign Het
Dnah7c A G 1: 46,672,521 E2636G possibly damaging Het
Gm13090 A T 4: 151,089,628 probably benign Het
Nceh1 T A 3: 27,241,271 L227* probably null Het
Nedd9 A G 13: 41,315,802 M625T probably damaging Het
Olfr1426 T A 19: 12,088,496 M99L probably benign Het
Olfr148 A T 9: 39,613,773 M69L probably benign Het
Olfr464 G A 11: 87,914,850 Q19* probably null Het
Olfr920 A G 9: 38,755,828 I47V probably benign Het
Pcsk4 T C 10: 80,325,101 N297S probably damaging Het
Psg21 T A 7: 18,652,591 I157F probably damaging Het
Rabep2 T C 7: 126,440,197 V294A probably benign Het
Rsph1 A G 17: 31,277,252 S2P unknown Het
Sacs A G 14: 61,210,518 K3338E probably damaging Het
Slc35f4 T G 14: 49,318,960 N112T probably benign Het
Slc43a3 T C 2: 84,938,285 F83L probably damaging Het
Slc6a15 T C 10: 103,393,914 V154A probably damaging Het
Synj2 T A 17: 5,986,014 M1K probably null Het
Tcp1 G A 17: 12,923,253 R378Q probably damaging Het
Tead2 A G 7: 45,217,234 T6A probably benign Het
Tpte G T 8: 22,355,475 V514L probably damaging Het
Trpm6 A G 19: 18,830,297 N1069D probably damaging Het
Uhrf1bp1l T A 10: 89,805,684 S906T probably benign Het
Vmn2r105 C A 17: 20,208,343 G824C probably damaging Het
Yod1 G A 1: 130,717,538 G19S probably damaging Het
Zfp934 A T 13: 62,492,932 N2K probably damaging Het
Other mutations in AI182371
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02338:AI182371 APN 2 35085716 missense probably benign 0.02
IGL02344:AI182371 APN 2 35089186 missense probably benign 0.01
IGL02817:AI182371 APN 2 35100649 missense probably damaging 0.99
IGL02961:AI182371 APN 2 35086112 missense possibly damaging 0.53
3-1:AI182371 UTSW 2 35100607 missense probably damaging 0.99
R0041:AI182371 UTSW 2 35085721 missense possibly damaging 0.79
R0084:AI182371 UTSW 2 35085702 critical splice donor site probably null
R0472:AI182371 UTSW 2 35085206 missense probably benign 0.35
R1539:AI182371 UTSW 2 35088803 missense probably damaging 0.98
R1634:AI182371 UTSW 2 35086485 missense probably damaging 1.00
R1635:AI182371 UTSW 2 35088737 splice site probably null
R1898:AI182371 UTSW 2 35100649 missense probably damaging 0.99
R2065:AI182371 UTSW 2 35086429 critical splice donor site probably null
R2155:AI182371 UTSW 2 35085354 missense probably benign 0.00
R3694:AI182371 UTSW 2 35085752 missense probably benign 0.00
R3900:AI182371 UTSW 2 35085216 missense probably benign 0.01
R4766:AI182371 UTSW 2 35095817 missense possibly damaging 0.78
R5071:AI182371 UTSW 2 35085215 missense probably benign 0.17
R5500:AI182371 UTSW 2 35100638 missense probably damaging 0.99
R5907:AI182371 UTSW 2 35086122 missense possibly damaging 0.66
R6146:AI182371 UTSW 2 35097971 missense probably damaging 1.00
R6333:AI182371 UTSW 2 35085269 missense probably damaging 0.99
R6732:AI182371 UTSW 2 35084705 intron probably benign
R6742:AI182371 UTSW 2 35084705 intron probably benign
R6781:AI182371 UTSW 2 35084705 intron probably benign
R7196:AI182371 UTSW 2 35086429 critical splice donor site probably null
R7381:AI182371 UTSW 2 35085359 missense probably damaging 1.00
R7458:AI182371 UTSW 2 35086504 missense possibly damaging 0.95
R7466:AI182371 UTSW 2 35088741 nonsense probably null
RF009:AI182371 UTSW 2 35089197 missense possibly damaging 0.90
Z1177:AI182371 UTSW 2 35095759 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGCTGCCTATGGTTTCCTGG -3'
(R):5'- CACATCCATCTGTCAAGTCACTG -3'

Sequencing Primer
(F):5'- CCTTGACTCTGGACAGGTG -3'
(R):5'- GCTTCTATGAGGGTGCTCCAC -3'
Posted On2018-08-01