Incidental Mutation 'R6776:Slc11a1'
ID531271
Institutional Source Beutler Lab
Gene Symbol Slc11a1
Ensembl Gene ENSMUSG00000026177
Gene Namesolute carrier family 11 (proton-coupled divalent metal ion transporters), member 1
Synonymshost resistance locus Bcg/Ity/Lsh, Nramp, ity, Lsh, Ity, Bcg, Nramp1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R6776 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location74375195-74386062 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 74384085 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 365 (I365N)
Ref Sequence ENSEMBL: ENSMUSP00000139455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027368] [ENSMUST00000187516]
Predicted Effect probably damaging
Transcript: ENSMUST00000027368
AA Change: I406N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027368
Gene: ENSMUSG00000026177
AA Change: I406N

DomainStartEndE-ValueType
Pfam:Nramp 75 460 1.5e-119 PFAM
transmembrane domain 464 486 N/A INTRINSIC
transmembrane domain 491 513 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000187516
AA Change: I365N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139455
Gene: ENSMUSG00000026177
AA Change: I365N

DomainStartEndE-ValueType
Pfam:Nramp 46 419 1.4e-109 PFAM
transmembrane domain 423 445 N/A INTRINSIC
transmembrane domain 450 472 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the solute carrier family 11 (proton-coupled divalent metal ion transporters) family and encodes a multi-pass membrane protein. The protein functions as a divalent transition metal (iron and manganese) transporter involved in iron metabolism and host resistance to certain pathogens. Mutations in this gene have been associated with susceptibility to infectious diseases such as tuberculosis and leprosy, and inflammatory diseases such as rheumatoid arthritis and Crohn disease. Alternatively spliced variants that encode different protein isoforms have been described but the full-length nature of only one has been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene are associated with susceptibility to infection with pathogens, including Myobacterium, Salmonella and Leishmania. Depending on the mutation, mutants may exhibit either increased or decreased susceptibility to infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik C A 1: 43,742,391 N144K probably damaging Het
2900011O08Rik T A 16: 13,986,806 S6T possibly damaging Het
Abhd13 A G 8: 9,988,075 H224R probably benign Het
Anapc10 T C 8: 79,719,745 F68S probably damaging Het
Arid2 A G 15: 96,370,949 N981S probably benign Het
BC055324 T C 1: 163,976,749 I338M probably damaging Het
Cfap73 A G 5: 120,634,211 F9L probably damaging Het
Chd3 A C 11: 69,354,470 L1141V probably damaging Het
Daam1 C T 12: 71,989,808 L1052F possibly damaging Het
Dmxl1 C T 18: 49,893,974 R2050C probably damaging Het
Dpp10 G A 1: 123,367,656 Q552* probably null Het
Dysf A G 6: 84,064,894 D160G possibly damaging Het
Foxp1 TTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG 6: 99,075,965 probably benign Het
Ftcd T C 10: 76,589,239 I518T probably benign Het
Gapdh A G 6: 125,162,273 S248P probably damaging Het
Gm5592 C G 7: 41,289,729 P812A probably damaging Het
Grik2 G A 10: 49,355,989 L482F probably damaging Het
Gzmg C T 14: 56,156,831 G202D probably damaging Het
Hectd4 G A 5: 121,353,511 A3671T possibly damaging Het
Hexa G T 9: 59,558,072 W203C probably damaging Het
Igdcc4 A T 9: 65,135,418 T1217S probably benign Het
Ipo7 A G 7: 110,047,065 D557G probably damaging Het
Irx3 T A 8: 91,799,835 T414S probably benign Het
Jakmip1 G A 5: 37,187,154 E1313K probably damaging Het
Kbtbd12 T C 6: 88,618,266 D194G probably damaging Het
Klk6 T C 7: 43,826,874 L46P probably damaging Het
Krt86 T C 15: 101,476,936 I329T probably benign Het
Mroh5 A G 15: 73,789,968 probably null Het
Mtrf1 T C 14: 79,413,081 V323A probably damaging Het
Oas3 A T 5: 120,758,874 I894N probably damaging Het
Oplah C T 15: 76,300,853 V887I possibly damaging Het
Pag1 T C 3: 9,699,788 T102A probably benign Het
Pcnx C T 12: 81,962,722 A1181V possibly damaging Het
Pkdrej G T 15: 85,817,309 Y1475* probably null Het
Pla2g5 A G 4: 138,800,653 S101P probably benign Het
Plekha4 C A 7: 45,534,817 A76E probably damaging Het
Plk2 T C 13: 110,399,791 I592T probably benign Het
Ppp2r3a A T 9: 101,212,862 H87Q probably benign Het
Ppp2r3c T A 12: 55,298,467 R79* probably null Het
Prpf40b C T 15: 99,314,903 R627W probably damaging Het
Prrt4 G T 6: 29,176,552 T258K possibly damaging Het
Rhpn2 T A 7: 35,383,769 probably null Het
Slc7a7 C T 14: 54,374,651 G265D possibly damaging Het
Thsd7a T A 6: 12,555,637 T83S possibly damaging Het
Tln2 A G 9: 67,262,905 S1989P probably damaging Het
Tnfaip3 T G 10: 19,005,576 T321P probably benign Het
Tnrc6b C T 15: 80,924,119 P1623L possibly damaging Het
Trpa1 T C 1: 14,912,377 N85S probably benign Het
Trrap C T 5: 144,851,256 R3544* probably null Het
Ttf2 A T 3: 100,952,553 V695E probably benign Het
Ttll4 A G 1: 74,681,353 E509G probably damaging Het
Vdr T C 15: 97,869,828 I94V probably damaging Het
Wdfy3 G T 5: 101,884,045 Q2304K possibly damaging Het
Zfp663 T C 2: 165,359,015 Y33C probably damaging Het
Other mutations in Slc11a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Slc11a1 APN 1 74381898 splice site probably null
IGL00813:Slc11a1 APN 1 74383480 missense probably benign 0.03
IGL00970:Slc11a1 APN 1 74380662 missense probably damaging 1.00
IGL01017:Slc11a1 APN 1 74379796 missense probably damaging 1.00
IGL01646:Slc11a1 APN 1 74384740 missense probably damaging 0.99
IGL01941:Slc11a1 APN 1 74377179 missense probably damaging 1.00
IGL01996:Slc11a1 APN 1 74376806 missense possibly damaging 0.93
IGL02580:Slc11a1 APN 1 74380259 missense probably damaging 0.99
IGL02586:Slc11a1 APN 1 74385132 splice site probably benign
IGL02961:Slc11a1 APN 1 74377173 missense probably damaging 1.00
R1813:Slc11a1 UTSW 1 74375772 missense probably benign
R1896:Slc11a1 UTSW 1 74375772 missense probably benign
R2219:Slc11a1 UTSW 1 74380665 missense probably damaging 0.98
R2220:Slc11a1 UTSW 1 74380665 missense probably damaging 0.98
R2416:Slc11a1 UTSW 1 74383644 missense probably damaging 0.96
R2432:Slc11a1 UTSW 1 74383751 splice site probably benign
R3893:Slc11a1 UTSW 1 74384706 missense probably damaging 1.00
R4450:Slc11a1 UTSW 1 74385535 utr 3 prime probably benign
R4638:Slc11a1 UTSW 1 74375278 start gained probably benign
R4782:Slc11a1 UTSW 1 74384088 missense probably damaging 0.98
R5068:Slc11a1 UTSW 1 74385184 missense probably damaging 1.00
R5069:Slc11a1 UTSW 1 74385184 missense probably damaging 1.00
R5070:Slc11a1 UTSW 1 74385184 missense probably damaging 1.00
R5215:Slc11a1 UTSW 1 74383777 intron probably benign
R5333:Slc11a1 UTSW 1 74384145 missense probably damaging 1.00
R5613:Slc11a1 UTSW 1 74380906 missense probably damaging 1.00
R5621:Slc11a1 UTSW 1 74380906 missense probably damaging 1.00
R5622:Slc11a1 UTSW 1 74380906 missense probably damaging 1.00
R5950:Slc11a1 UTSW 1 74377176 missense probably benign 0.40
R6239:Slc11a1 UTSW 1 74384115 missense possibly damaging 0.82
R7199:Slc11a1 UTSW 1 74383671 missense possibly damaging 0.83
R7356:Slc11a1 UTSW 1 74385489 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGTTCCATATTCAGCAAACCAG -3'
(R):5'- CTGTGAGTGTTTAGGGCAAACC -3'

Sequencing Primer
(F):5'- GTTCCATATTCAGCAAACCAGTTATG -3'
(R):5'- GGCAAACCCCATAGGACTGTTG -3'
Posted On2018-08-29