Incidental Mutation 'R6786:Trim55'
ID532355
Institutional Source Beutler Lab
Gene Symbol Trim55
Ensembl Gene ENSMUSG00000060913
Gene Nametripartite motif-containing 55
SynonymsD830041C10Rik, Murf2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6786 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location19644474-19692421 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19672774 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 335 (D335G)
Ref Sequence ENSEMBL: ENSMUSP00000029139 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029139]
Predicted Effect probably benign
Transcript: ENSMUST00000029139
AA Change: D335G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000029139
Gene: ENSMUSG00000060913
AA Change: D335G

DomainStartEndE-ValueType
RING 26 81 3.69e-8 SMART
BBOX 119 161 3.58e-6 SMART
Blast:BBC 168 294 2e-33 BLAST
PDB:4M3L|D 215 272 2e-12 PDB
low complexity region 329 355 N/A INTRINSIC
low complexity region 384 398 N/A INTRINSIC
low complexity region 474 485 N/A INTRINSIC
low complexity region 514 526 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 96.1%
Validation Efficiency 96% (66/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING zinc finger, a motif known to be involved in protein-protein interactions. This protein associates transiently with microtubules, myosin, and titin during muscle sarcomere assembly. It may act as a transient adaptor and plays a regulatory role in the assembly of sarcomeres. Four alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased heart and muscle to body weight ratios and cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl7a C A 4: 56,744,116 Y214* probably null Het
Adnp2 A G 18: 80,129,745 V483A probably benign Het
Aif1 C T 17: 35,171,496 V93M probably damaging Het
Alpk2 A G 18: 65,306,634 S563P probably benign Het
Ank2 A T 3: 126,958,932 N378K probably damaging Het
Ano4 C T 10: 88,992,870 probably null Het
Asxl3 G A 18: 22,525,440 C2169Y probably damaging Het
Atp2b1 T C 10: 99,016,959 C101R probably damaging Het
BC052040 A G 2: 115,631,981 I65V probably benign Het
Bcs1l C T 1: 74,590,685 R224C probably damaging Het
Car2 T C 3: 14,886,650 probably benign Het
Cbln1 T C 8: 87,472,029 N71S probably benign Het
Cdh8 T A 8: 99,223,947 T224S probably benign Het
Cep131 G A 11: 120,065,392 R1014W probably damaging Het
Cfap61 T C 2: 146,045,443 S603P possibly damaging Het
Chd8 G T 14: 52,226,668 L659I probably benign Het
Ckap5 G A 2: 91,557,575 G255D probably benign Het
Clec18a C A 8: 111,080,940 W126L probably benign Het
Cux1 T A 5: 136,567,231 N4Y probably damaging Het
Dgcr8 A T 16: 18,283,829 Y196* probably null Het
Dnah14 A T 1: 181,641,405 I1267F probably benign Het
Dock7 T C 4: 99,061,292 N438D probably benign Het
Dock8 A T 19: 25,183,022 H1763L possibly damaging Het
Fpr-rs6 A T 17: 20,182,838 M87K possibly damaging Het
Gabrg1 A G 5: 70,754,267 S339P probably benign Het
Gm10801 AAGT AAGTAGT 2: 98,663,803 probably null Het
Gm11487 A T 4: 73,403,606 M64K possibly damaging Het
Gm12695 A G 4: 96,762,821 S132P probably damaging Het
Gm3443 T A 19: 21,555,764 C31S probably damaging Het
Gm9573 T C 17: 35,623,165 probably benign Het
Gzmf A T 14: 56,206,995 F40L probably benign Het
Herc1 TCCC TCC 9: 66,501,188 probably null Het
Ikbkap T C 4: 56,771,555 D914G possibly damaging Het
Lrguk A G 6: 34,095,587 E604G probably benign Het
Marveld3 C A 8: 109,948,100 K361N probably benign Het
Mgat4b A T 11: 50,230,698 Y47F probably damaging Het
Mmel1 G T 4: 154,892,428 E520* probably null Het
Myod1 A G 7: 46,378,317 T294A probably benign Het
Nfix A T 8: 84,727,647 S219T probably damaging Het
Nr4a2 A G 2: 57,111,908 F115L probably benign Het
Numa1 A C 7: 101,992,638 M98L probably benign Het
Olfr1458 T C 19: 13,103,203 I28V probably benign Het
P3h1 C T 4: 119,237,954 L303F possibly damaging Het
Pias4 G A 10: 81,157,246 T5I probably damaging Het
Pik3ip1 A G 11: 3,332,124 N68S probably benign Het
Pkdrej T C 15: 85,818,649 T1029A probably benign Het
Recql A T 6: 142,364,552 D517E probably benign Het
Sall2 G T 14: 52,314,621 H372Q probably damaging Het
Scn8a A C 15: 101,032,215 I1436L probably benign Het
Slc4a5 T C 6: 83,296,747 probably null Het
Stox2 A C 8: 47,186,465 F898C probably damaging Het
Sumo2 A T 11: 115,523,775 probably null Het
Sycp2 C T 2: 178,383,552 E366K possibly damaging Het
Tanc1 A G 2: 59,791,806 K423R probably benign Het
Tbx21 T A 11: 97,115,046 Q31L possibly damaging Het
Tcrg-C1 A T 13: 19,216,476 D125V unknown Het
Tfap2a T A 13: 40,728,754 N25I probably damaging Het
Tfdp1 C T 8: 13,370,485 R105W probably damaging Het
Trav18 G A 14: 53,831,665 V55I probably benign Het
Trim71 T A 9: 114,512,704 T837S probably benign Het
Vmn1r56 T C 7: 5,195,962 T219A probably benign Het
Vmn2r17 A T 5: 109,427,829 T189S probably benign Het
Xaf1 A G 11: 72,306,635 T146A probably benign Het
Zdbf2 T C 1: 63,304,520 V686A possibly damaging Het
Zfp65 T C 13: 67,708,011 H383R probably damaging Het
Zfp932 A G 5: 110,009,740 T435A probably damaging Het
Zfp947 C T 17: 22,145,769 G308D probably benign Het
Zswim3 T A 2: 164,820,851 V417E probably damaging Het
Other mutations in Trim55
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02948:Trim55 APN 3 19670952 missense probably damaging 1.00
IGL03095:Trim55 APN 3 19674465 missense probably benign 0.00
IGL03411:Trim55 APN 3 19659190 missense probably damaging 0.99
R0011:Trim55 UTSW 3 19670999 missense probably benign 0.00
R0021:Trim55 UTSW 3 19644702 missense probably benign 0.04
R0021:Trim55 UTSW 3 19644702 missense probably benign 0.04
R0194:Trim55 UTSW 3 19661861 missense probably benign 0.00
R0437:Trim55 UTSW 3 19670978 missense probably benign
R0450:Trim55 UTSW 3 19671092 missense possibly damaging 0.55
R0469:Trim55 UTSW 3 19671092 missense possibly damaging 0.55
R1029:Trim55 UTSW 3 19644742 missense probably damaging 1.00
R1397:Trim55 UTSW 3 19644637 missense probably benign 0.01
R1928:Trim55 UTSW 3 19661882 critical splice donor site probably null
R2079:Trim55 UTSW 3 19644666 missense probably damaging 0.98
R3856:Trim55 UTSW 3 19672956 missense probably benign
R4646:Trim55 UTSW 3 19671122 missense probably benign 0.03
R4907:Trim55 UTSW 3 19674374 missense probably benign
R5090:Trim55 UTSW 3 19671607 missense probably benign 0.08
R5562:Trim55 UTSW 3 19659153 missense probably benign 0.04
R6370:Trim55 UTSW 3 19691486 missense possibly damaging 0.87
R6658:Trim55 UTSW 3 19691555 missense probably damaging 1.00
R8147:Trim55 UTSW 3 19672847 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TACCAAGGTGCATGTAAGAACCAC -3'
(R):5'- TGGTTACCTGTGTCACCAGG -3'

Sequencing Primer
(F):5'- CAAGATTTCAACATCGTAGACCTGG -3'
(R):5'- GTCACCAGGACATCTGCAG -3'
Posted On2018-08-29