Incidental Mutation 'R6801:Dennd4b'
ID533330
Institutional Source Beutler Lab
Gene Symbol Dennd4b
Ensembl Gene ENSMUSG00000042404
Gene NameDENN/MADD domain containing 4B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.275) question?
Stock #R6801 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location90265185-90280669 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 90268779 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 201 (V201E)
Ref Sequence ENSEMBL: ENSMUSP00000117354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029545] [ENSMUST00000098914] [ENSMUST00000129564] [ENSMUST00000184882]
Predicted Effect probably benign
Transcript: ENSMUST00000029545
SMART Domains Protein: ENSMUSP00000029545
Gene: ENSMUSG00000027936

DomainStartEndE-ValueType
Pfam:TORC_N 18 72 1.8e-20 PFAM
low complexity region 127 141 N/A INTRINSIC
Pfam:TORC_M 168 323 3.7e-71 PFAM
low complexity region 335 384 N/A INTRINSIC
low complexity region 391 416 N/A INTRINSIC
low complexity region 432 439 N/A INTRINSIC
low complexity region 484 494 N/A INTRINSIC
low complexity region 517 528 N/A INTRINSIC
Pfam:TORC_C 614 691 4.3e-31 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098914
AA Change: V212E

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000096514
Gene: ENSMUSG00000042404
AA Change: V212E

DomainStartEndE-ValueType
low complexity region 8 15 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
uDENN 183 290 1.15e-29 SMART
DENN 324 508 5.26e-70 SMART
dDENN 573 647 1.75e-25 SMART
low complexity region 672 690 N/A INTRINSIC
low complexity region 740 752 N/A INTRINSIC
coiled coil region 902 928 N/A INTRINSIC
low complexity region 1022 1038 N/A INTRINSIC
low complexity region 1086 1096 N/A INTRINSIC
low complexity region 1114 1127 N/A INTRINSIC
low complexity region 1131 1148 N/A INTRINSIC
low complexity region 1338 1350 N/A INTRINSIC
low complexity region 1424 1439 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000129564
AA Change: V201E

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117354
Gene: ENSMUSG00000042404
AA Change: V201E

DomainStartEndE-ValueType
low complexity region 32 46 N/A INTRINSIC
uDENN 172 279 1.15e-29 SMART
DENN 313 497 5.26e-70 SMART
dDENN 562 636 1.75e-25 SMART
low complexity region 661 679 N/A INTRINSIC
low complexity region 729 741 N/A INTRINSIC
coiled coil region 891 917 N/A INTRINSIC
low complexity region 1011 1027 N/A INTRINSIC
low complexity region 1075 1085 N/A INTRINSIC
low complexity region 1103 1116 N/A INTRINSIC
low complexity region 1120 1137 N/A INTRINSIC
low complexity region 1327 1339 N/A INTRINSIC
low complexity region 1413 1428 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000151648
SMART Domains Protein: ENSMUSP00000121350
Gene: ENSMUSG00000042404

DomainStartEndE-ValueType
uDENN 2 57 3.71e-6 SMART
Pfam:DENN 91 157 2.9e-13 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000118483
Gene: ENSMUSG00000042404
AA Change: V192E

DomainStartEndE-ValueType
low complexity region 24 38 N/A INTRINSIC
Blast:uDENN 39 97 9e-6 BLAST
Blast:uDENN 164 207 1e-22 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000184882
SMART Domains Protein: ENSMUSP00000139194
Gene: ENSMUSG00000027936

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Pfam:TORC_M 83 239 6.5e-65 PFAM
low complexity region 250 299 N/A INTRINSIC
low complexity region 306 331 N/A INTRINSIC
low complexity region 347 354 N/A INTRINSIC
low complexity region 399 409 N/A INTRINSIC
low complexity region 432 443 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.8%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 T A 8: 24,684,664 Y695F possibly damaging Het
Arhgap20 A G 9: 51,848,592 D545G probably damaging Het
Arhgef11 A G 3: 87,735,852 E1457G possibly damaging Het
Atp2b4 T A 1: 133,727,786 I747F probably damaging Het
Bche T A 3: 73,701,800 I98L probably benign Het
C2cd6 TC T 1: 59,094,583 probably null Het
Ccdc90b A G 7: 92,567,735 T72A probably benign Het
Chrd A G 16: 20,735,747 E352G possibly damaging Het
Csmd2 A G 4: 128,383,950 E953G probably benign Het
Dchs2 T A 3: 83,128,534 M196K probably benign Het
Ddx10 G A 9: 53,247,907 Q33* probably null Het
Fbn2 T A 18: 58,113,348 H494L probably benign Het
Fbxw13 G A 9: 109,194,727 A83V probably null Het
Fxr1 A G 3: 34,054,303 D321G possibly damaging Het
Galm A G 17: 80,181,624 H233R probably benign Het
Gm7298 A G 6: 121,775,809 T837A probably benign Het
Gmppa C G 1: 75,441,747 S258C possibly damaging Het
Hk1 T G 10: 62,281,131 E645A probably damaging Het
Igkv1-132 A G 6: 67,760,340 T97A probably damaging Het
Kcnc1 T C 7: 46,435,292 F547L probably damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lingo2 T A 4: 35,709,566 E138V probably damaging Het
Myb T C 10: 21,144,966 probably null Het
Mybl1 A G 1: 9,683,128 V243A probably benign Het
Mylk4 C T 13: 32,728,410 S189N probably benign Het
Olfr1133 A G 2: 87,645,323 Y267H probably benign Het
Olfr1267-ps1 A T 2: 90,085,609 I284N probably damaging Het
Olfr1283 A T 2: 111,369,049 Q139L probably benign Het
Olfr1388 A G 11: 49,444,342 M164V probably benign Het
Olfr155 T A 4: 43,855,206 L299* probably null Het
Olfr27 A T 9: 39,144,210 I37F probably benign Het
Oxld1 A T 11: 120,456,824 D182E probably damaging Het
Phf13 A T 4: 151,991,560 L295Q probably damaging Het
Prrc2c TTGCTGCTGCTGCTGCTGCTGCTGCTGC TTGCTGCTGCTGCTGCTGCTGCTGC 1: 162,709,061 probably benign Het
Prss33 A G 17: 23,834,839 L88P possibly damaging Het
Ralgds A G 2: 28,548,436 Y596C probably damaging Het
Rftn2 A G 1: 55,194,259 I379T possibly damaging Het
Rnf214 C T 9: 45,896,105 E267K probably damaging Het
Rpp14 T C 14: 8,083,717 probably benign Het
Rpusd2 A G 2: 119,035,395 Y191C probably damaging Het
Serpinb9c T A 13: 33,157,824 M1L probably benign Het
Shroom3 A G 5: 92,940,936 D434G probably damaging Het
Smc5 G A 19: 23,214,646 S888L probably benign Het
Suv39h2 C T 2: 3,464,421 R299K probably benign Het
Trappc4 A T 9: 44,404,388 I176N probably damaging Het
Trim12c A T 7: 104,348,130 V73E probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Other mutations in Dennd4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Dennd4b APN 3 90271207 missense possibly damaging 0.83
IGL00834:Dennd4b APN 3 90279686 critical splice donor site probably null
IGL01124:Dennd4b APN 3 90269074 missense possibly damaging 0.61
IGL01792:Dennd4b APN 3 90279845 missense probably damaging 0.96
IGL01895:Dennd4b APN 3 90275567 missense probably benign 0.00
IGL02533:Dennd4b APN 3 90272310 missense probably benign 0.02
IGL02630:Dennd4b APN 3 90272977 missense probably benign 0.00
R0107:Dennd4b UTSW 3 90272736 missense possibly damaging 0.92
R0143:Dennd4b UTSW 3 90272364 missense probably damaging 1.00
R1079:Dennd4b UTSW 3 90271178 missense probably benign
R1306:Dennd4b UTSW 3 90271165 missense probably benign 0.00
R1525:Dennd4b UTSW 3 90270870 missense probably damaging 0.97
R1756:Dennd4b UTSW 3 90271605 missense probably damaging 1.00
R1959:Dennd4b UTSW 3 90268773 missense probably damaging 1.00
R1976:Dennd4b UTSW 3 90273055 missense probably damaging 1.00
R2184:Dennd4b UTSW 3 90275540 missense probably damaging 1.00
R2296:Dennd4b UTSW 3 90275514 missense probably damaging 1.00
R2406:Dennd4b UTSW 3 90275488 missense probably damaging 1.00
R2408:Dennd4b UTSW 3 90271575 nonsense probably null
R4691:Dennd4b UTSW 3 90272312 missense probably damaging 1.00
R5376:Dennd4b UTSW 3 90278056 missense probably benign 0.00
R5466:Dennd4b UTSW 3 90268500 splice site probably null
R5555:Dennd4b UTSW 3 90268368 missense probably damaging 1.00
R5556:Dennd4b UTSW 3 90268368 missense probably damaging 1.00
R5557:Dennd4b UTSW 3 90268368 missense probably damaging 1.00
R5605:Dennd4b UTSW 3 90268368 missense probably damaging 1.00
R5617:Dennd4b UTSW 3 90275626 missense probably benign
R5692:Dennd4b UTSW 3 90277783 missense probably damaging 1.00
R5790:Dennd4b UTSW 3 90277450 missense probably damaging 1.00
R5957:Dennd4b UTSW 3 90270965 missense probably damaging 1.00
R6130:Dennd4b UTSW 3 90276259 missense probably damaging 1.00
R6183:Dennd4b UTSW 3 90275568 utr 3 prime probably benign
R6505:Dennd4b UTSW 3 90267611 missense probably damaging 1.00
R6631:Dennd4b UTSW 3 90277732 splice site probably null
R7409:Dennd4b UTSW 3 90273952 missense probably benign 0.15
R7457:Dennd4b UTSW 3 90269315 missense probably benign
R7650:Dennd4b UTSW 3 90268749 nonsense probably null
X0024:Dennd4b UTSW 3 90270971 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- CATTGACACCAGGCCAGATC -3'
(R):5'- CTCTATACCCCAGCAGGATTAAGAG -3'

Sequencing Primer
(F):5'- CCAGATCAGAAGTGACTTGGTG -3'
(R):5'- GCAGGATTAAGAGTACATATTAGAGC -3'
Posted On2018-09-12