Incidental Mutation 'R6802:Socs1'
ID533403
Institutional Source Beutler Lab
Gene Symbol Socs1
Ensembl Gene ENSMUSG00000038037
Gene Namesuppressor of cytokine signaling 1
SynonymsCish1, JAB, JAK-binding protein, SOCS-1, STAT-induced STAT inhibitor 1, Cish7, SSI-1, JAK2-binding protein
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6802 (G1)
Quality Score144.008
Status Validated
Chromosome16
Chromosomal Location10782240-10785536 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 10784358 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 172 (V172L)
Ref Sequence ENSEMBL: ENSMUSP00000155530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038099] [ENSMUST00000051297] [ENSMUST00000229866]
Predicted Effect probably benign
Transcript: ENSMUST00000038099
AA Change: V172L

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000038121
Gene: ENSMUSG00000038037
AA Change: V172L

DomainStartEndE-ValueType
low complexity region 14 51 N/A INTRINSIC
SH2 78 161 1.29e-21 SMART
SOCS 166 209 2.48e-14 SMART
SOCS_box 172 208 9.01e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000051297
SMART Domains Protein: ENSMUSP00000053078
Gene: ENSMUSG00000043050

DomainStartEndE-ValueType
Pfam:TP2 1 117 4.1e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229866
AA Change: V172L

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.0955 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the STAT-induced STAT inhibitor (SSI), also known as suppressor of cytokine signaling (SOCS), family. SSI family members are cytokine-inducible negative regulators of cytokine signaling. The expression of this gene can be induced by a subset of cytokines, including IL2, IL3 erythropoietin (EPO), CSF2/GM-CSF, and interferon (IFN)-gamma. The protein encoded by this gene functions downstream of cytokine receptors, and takes part in a negative feedback loop to attenuate cytokine signaling. Knockout studies in mice suggested the role of this gene as a modulator of IFN-gamma action, which is required for normal postnatal growth and survival. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit retarded growth, hyperresponsiveness to endogenous interferon gamma, hepatitis with fatty degeneration, lymphopenia due to excess apoptosis, monocytic organ infiltration, and lethality by 3 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110004F10Rik A T 7: 116,099,490 K38N probably damaging Het
Agap3 T A 5: 24,487,793 I408N possibly damaging Het
Apold1 G A 6: 134,983,730 R49H probably damaging Het
Apopt1 G T 12: 111,751,191 G162W probably benign Het
Arfgef1 A T 1: 10,189,452 M597K probably benign Het
Bsn C T 9: 108,110,624 probably benign Het
Ccdc177 A T 12: 80,759,283 D72E probably damaging Het
Ctdp1 A T 18: 80,420,441 probably null Het
Ctsj A T 13: 61,003,074 L190M probably benign Het
Dhx57 A G 17: 80,275,321 F285S probably benign Het
Dnah2 A T 11: 69,423,690 V4051E probably damaging Het
F5 A T 1: 164,179,356 D243V probably damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Fbxo30 G T 10: 11,291,480 G649C probably damaging Het
Focad T C 4: 88,274,203 S590P unknown Het
Focad G A 4: 88,344,684 V973I unknown Het
Glb1l3 T C 9: 26,859,352 probably null Het
Gli2 G A 1: 118,842,065 R586C probably damaging Het
Gm6401 T A 14: 41,966,917 E65V probably damaging Het
Gml2 T A 15: 74,824,246 L163H probably damaging Het
Grm6 A T 11: 50,853,389 Q229L probably benign Het
Gtf2h2 T C 13: 100,480,543 M252V probably benign Het
Hsf4 G A 8: 105,274,668 G309S probably damaging Het
Iglc1 T C 16: 19,061,910 probably benign Het
Irgq A G 7: 24,531,651 E89G probably benign Het
Kcnj6 T C 16: 94,762,577 N354S probably benign Het
Lrguk A G 6: 34,062,457 H301R probably damaging Het
Mc4r C A 18: 66,859,417 M208I probably benign Het
Mrpl15 A G 1: 4,776,730 S208P probably benign Het
Neil2 A G 14: 63,191,814 F10S probably damaging Het
Nrg1 T C 8: 31,821,264 R476G probably damaging Het
Olfr1054 G T 2: 86,333,185 T57K possibly damaging Het
Olfr1186 A G 2: 88,525,597 T5A probably benign Het
Olfr360 A G 2: 37,068,415 M37V probably benign Het
Pacs1 T C 19: 5,152,784 I357V probably damaging Het
Pla2g15 T C 8: 106,150,581 L32P probably damaging Het
Pms1 A T 1: 53,206,792 S529R probably benign Het
Prkra A T 2: 76,633,537 D260E probably damaging Het
Qsox1 A C 1: 155,795,393 F127V probably damaging Het
Rabgap1l A T 1: 160,733,680 V161E probably benign Het
Robo1 T G 16: 72,933,313 V214G probably benign Het
Ryr2 G A 13: 11,686,966 A2935V probably damaging Het
Sgtb A T 13: 104,132,050 Q198L probably benign Het
Slc39a12 C T 2: 14,420,085 L376F probably benign Het
Sprr2k A G 3: 92,433,364 probably benign Het
Tgm1 C T 14: 55,712,482 probably benign Het
Tph2 A T 10: 115,184,873 M6K probably damaging Het
Trav16 T A 14: 53,743,484 C43* probably null Het
Ttll5 A G 12: 85,879,386 E318G probably damaging Het
Vmn2r90 T A 17: 17,712,089 I86N probably damaging Het
Zdhhc19 T C 16: 32,506,358 S165P possibly damaging Het
Zfp352 A T 4: 90,225,200 T526S probably benign Het
Other mutations in Socs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03002:Socs1 APN 16 10784540 missense probably damaging 0.98
minipad UTSW 16 10784530 missense probably damaging 1.00
R0670:Socs1 UTSW 16 10784262 missense probably damaging 1.00
R3027:Socs1 UTSW 16 10784714 missense possibly damaging 0.92
R4509:Socs1 UTSW 16 10784354 missense probably benign 0.10
R4993:Socs1 UTSW 16 10784685 missense probably benign 0.17
R6014:Socs1 UTSW 16 10784493 missense possibly damaging 0.66
R6059:Socs1 UTSW 16 10784530 missense probably damaging 1.00
R6897:Socs1 UTSW 16 10784402 missense probably benign 0.05
R8962:Socs1 UTSW 16 10784778 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- ATGAGGTCTCCAGCCAGAAGTG -3'
(R):5'- AACGGAACTGCTTCTTCGC -3'

Sequencing Primer
(F):5'- CCAGAAGTGGGAGGCATCTC -3'
(R):5'- GAACTGCTTCTTCGCGCTCAG -3'
Posted On2018-09-12