Incidental Mutation 'R6803:Uox'
ID533424
Institutional Source Beutler Lab
Gene Symbol Uox
Ensembl Gene ENSMUSG00000028186
Gene Nameurate oxidase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.407) question?
Stock #R6803 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location146570426-146632305 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 146612509 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 55 (V55G)
Ref Sequence ENSEMBL: ENSMUSP00000113649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029837] [ENSMUST00000121133] [ENSMUST00000147409] [ENSMUST00000199489] [ENSMUST00000200633]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029837
AA Change: V128G

PolyPhen 2 Score 0.596 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000029837
Gene: ENSMUSG00000028186
AA Change: V128G

DomainStartEndE-ValueType
Pfam:Uricase 19 144 8.7e-25 PFAM
Pfam:Uricase 153 292 5.6e-38 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000121133
AA Change: V55G

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113649
Gene: ENSMUSG00000028186
AA Change: V55G

DomainStartEndE-ValueType
Pfam:Uricase 2 72 1.2e-19 PFAM
Pfam:Uricase 79 181 8.5e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147409
SMART Domains Protein: ENSMUSP00000143299
Gene: ENSMUSG00000028186

DomainStartEndE-ValueType
Pfam:Uricase 1 73 1.1e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199489
AA Change: V104G

PolyPhen 2 Score 0.408 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000143418
Gene: ENSMUSG00000028186
AA Change: V104G

DomainStartEndE-ValueType
Pfam:Uricase 1 121 8.3e-35 PFAM
Pfam:Uricase 128 228 1.8e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200633
SMART Domains Protein: ENSMUSP00000142872
Gene: ENSMUSG00000028185

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:DNase_II 26 353 4.5e-117 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 94.7%
Validation Efficiency 100% (52/52)
MGI Phenotype PHENOTYPE: Homozygous null mutants exhibit marked hyperuricemia and urate nephropathy. Most mutants die prior to four weeks of age. Homozygotes for a large paracentric inversion disrupting this same gene exhibit a similar phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg9 A C 9: 50,789,560 D210A probably benign Het
As3mt T G 19: 46,709,581 M120R probably benign Het
Baz1a T A 12: 54,941,555 S270C probably null Het
Car5a A C 8: 121,923,765 probably null Het
Ccdc187 T A 2: 26,289,779 T223S probably benign Het
Cel T C 2: 28,558,048 N322S probably benign Het
Chd6 T C 2: 160,960,359 E2185G possibly damaging Het
Clcnkb T C 4: 141,405,328 T597A probably benign Het
Cntnap1 A G 11: 101,177,234 Y24C possibly damaging Het
Cog3 A G 14: 75,704,039 S817P probably benign Het
Col8a2 A G 4: 126,312,000 Y601C probably damaging Het
Cpm G T 10: 117,676,097 probably null Het
Cpt2 T C 4: 107,912,664 N79S probably damaging Het
Dnah17 T C 11: 118,125,372 T314A probably benign Het
Dnm1 C A 2: 32,312,754 V46F probably damaging Het
Fat3 C T 9: 15,996,787 V2640M probably damaging Het
Fbxl2 A T 9: 113,984,549 C296S probably damaging Het
Fcgbp A G 7: 28,103,212 T1522A probably benign Het
Foxl2 A C 9: 98,955,932 K91T probably damaging Het
Gm35339 A G 15: 76,356,576 Y488C probably damaging Het
Hdac11 G T 6: 91,166,265 R131L probably damaging Het
Ipo11 T C 13: 106,857,258 I723V probably benign Het
Klhl33 A G 14: 50,896,735 L150P probably damaging Het
Klk1b11 A G 7: 43,997,837 H65R probably damaging Het
Larp7 T C 3: 127,537,036 probably null Het
Ldlrad3 T C 2: 102,113,547 D60G possibly damaging Het
Mlip A T 9: 77,190,381 H177Q probably damaging Het
Mrnip A G 11: 50,199,903 D298G probably benign Het
Npas2 A C 1: 39,336,049 S483R probably benign Het
Nrg3 C A 14: 39,012,000 E310* probably null Het
Olfr1382 T A 11: 49,535,605 L140H probably damaging Het
Olfr504 G T 7: 108,565,413 D127E probably damaging Het
Omg T A 11: 79,502,268 T255S possibly damaging Het
Plekhg6 T C 6: 125,363,663 D578G probably damaging Het
Pygo1 A G 9: 72,942,985 K39E probably damaging Het
Rell2 A G 18: 37,956,941 D66G probably damaging Het
Samd9l A T 6: 3,375,446 I605K probably damaging Het
Sema6d T C 2: 124,664,050 S593P probably damaging Het
Sf3b3 A G 8: 110,825,578 V545A probably benign Het
Speer4f1 T A 5: 17,479,390 probably null Het
Spem1 T C 11: 69,821,148 E230G possibly damaging Het
Sphkap A G 1: 83,280,510 F171L probably damaging Het
Tbc1d13 T C 2: 30,135,510 probably benign Het
Tmem222 A T 4: 133,266,843 N206K probably benign Het
Trnau1ap C T 4: 132,321,770 V41M probably damaging Het
Ttn C T 2: 76,939,043 probably null Het
Ubr3 T C 2: 69,936,024 probably null Het
Vmn2r24 A T 6: 123,779,001 I11F possibly damaging Het
Wasf2 T C 4: 133,194,909 probably null Het
Zbtb4 T C 11: 69,778,628 S726P possibly damaging Het
Zfp534 C T 4: 147,674,469 C581Y probably damaging Het
Zfp551 A T 7: 12,417,181 C100* probably null Het
Other mutations in Uox
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Uox APN 3 146627810 missense probably benign 0.00
IGL00902:Uox APN 3 146610406 missense possibly damaging 0.95
IGL02409:Uox APN 3 146624626 missense probably benign 0.06
IGL02827:Uox APN 3 146597196 intron probably benign
IGL02979:Uox APN 3 146610491 splice site probably null
IGL03375:Uox APN 3 146625835 missense probably damaging 1.00
kamloops UTSW 3 146624577 nonsense probably null
R1350:Uox UTSW 3 146624575 missense probably damaging 1.00
R1634:Uox UTSW 3 146612383 nonsense probably null
R1900:Uox UTSW 3 146610379 missense probably damaging 1.00
R2000:Uox UTSW 3 146610399 missense possibly damaging 0.65
R2119:Uox UTSW 3 146612542 missense probably benign 0.01
R5329:Uox UTSW 3 146624545 missense probably damaging 1.00
R5606:Uox UTSW 3 146610302 nonsense probably null
R6281:Uox UTSW 3 146624577 nonsense probably null
R6327:Uox UTSW 3 146624577 nonsense probably null
R6337:Uox UTSW 3 146624577 nonsense probably null
R6364:Uox UTSW 3 146624577 nonsense probably null
R6365:Uox UTSW 3 146624577 nonsense probably null
R6369:Uox UTSW 3 146624577 nonsense probably null
R6483:Uox UTSW 3 146624577 nonsense probably null
R6492:Uox UTSW 3 146624577 nonsense probably null
R6494:Uox UTSW 3 146624577 nonsense probably null
R6556:Uox UTSW 3 146624648 critical splice donor site probably null
R7809:Uox UTSW 3 146627858 nonsense probably null
R7868:Uox UTSW 3 146610274 missense probably benign 0.01
R8131:Uox UTSW 3 146625834 missense probably damaging 1.00
R8931:Uox UTSW 3 146612292 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAAACATCGAGACCTTTGC -3'
(R):5'- AGAATTGCTTAGGGCCAAAAC -3'

Sequencing Primer
(F):5'- CGAGACCTTTGCAATGAACATCTG -3'
(R):5'- TTGCTTAGGGCCAAAACCAACAAG -3'
Posted On2018-09-12