Mutagenetix > Incidental Mutation

Incidental Mutation 'R6803:Uox'

533424

Institutional Source

Beutler Lab

Gene Symbol

Uox

Ensembl Gene

ENSMUSG00000028186

Gene Name

urate oxidase

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.505) question?

Stock #

R6803 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

146570426-146632305 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 146612509 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 55 (V55G)

Ref Sequence

ENSEMBL: ENSMUSP00000113649 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029837] [ENSMUST00000121133] [ENSMUST00000147409] [ENSMUST00000199489] [ENSMUST00000200633]

AlphaFold

P25688

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029837
AA Change: V128G

PolyPhen 2 Score 0.596 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000029837
Gene: ENSMUSG00000028186
AA Change: V128G

Domain	Start	End	E-Value	Type
Pfam:Uricase	19	144	8.7e-25	PFAM
Pfam:Uricase	153	292	5.6e-38	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000121133
AA Change: V55G

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000113649
Gene: ENSMUSG00000028186
AA Change: V55G

Domain	Start	End	E-Value	Type
Pfam:Uricase	2	72	1.2e-19	PFAM
Pfam:Uricase	79	181	8.5e-23	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000147409

SMART Domains

Protein: ENSMUSP00000143299
Gene: ENSMUSG00000028186

Domain	Start	End	E-Value	Type
Pfam:Uricase	1	73	1.1e-17	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000199489
AA Change: V104G

PolyPhen 2 Score 0.408 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000143418
Gene: ENSMUSG00000028186
AA Change: V104G

Domain	Start	End	E-Value	Type
Pfam:Uricase	1	121	8.3e-35	PFAM
Pfam:Uricase	128	228	1.8e-19	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000200633

SMART Domains

Protein: ENSMUSP00000142872
Gene: ENSMUSG00000028185

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:DNase_II	26	353	4.5e-117	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 98.0%
20x: 94.7%

Validation Efficiency

100% (52/52)

MGI Phenotype

PHENOTYPE: Homozygous null mutants exhibit marked hyperuricemia and urate nephropathy. Most mutants die prior to four weeks of age. Homozygotes for a large paracentric inversion disrupting this same gene exhibit a similar phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alg9	A	C	9: 50,789,560	D210A	probably benign	Het
As3mt	T	G	19: 46,709,581	M120R	probably benign	Het
Baz1a	T	A	12: 54,941,555	S270C	probably null	Het
Car5a	A	C	8: 121,923,765		probably null	Het
Ccdc187	T	A	2: 26,289,779	T223S	probably benign	Het
Cel	T	C	2: 28,558,048	N322S	probably benign	Het
Chd6	T	C	2: 160,960,359	E2185G	possibly damaging	Het
Clcnkb	T	C	4: 141,405,328	T597A	probably benign	Het
Cntnap1	A	G	11: 101,177,234	Y24C	possibly damaging	Het
Cog3	A	G	14: 75,704,039	S817P	probably benign	Het
Col8a2	A	G	4: 126,312,000	Y601C	probably damaging	Het
Cpm	G	T	10: 117,676,097		probably null	Het
Cpt2	T	C	4: 107,912,664	N79S	probably damaging	Het
Dnah17	T	C	11: 118,125,372	T314A	probably benign	Het
Dnm1	C	A	2: 32,312,754	V46F	probably damaging	Het
Fat3	C	T	9: 15,996,787	V2640M	probably damaging	Het
Fbxl2	A	T	9: 113,984,549	C296S	probably damaging	Het
Fcgbp	A	G	7: 28,103,212	T1522A	probably benign	Het
Foxl2	A	C	9: 98,955,932	K91T	probably damaging	Het
Gm35339	A	G	15: 76,356,576	Y488C	probably damaging	Het
Hdac11	G	T	6: 91,166,265	R131L	probably damaging	Het
Ipo11	T	C	13: 106,857,258	I723V	probably benign	Het
Klhl33	A	G	14: 50,896,735	L150P	probably damaging	Het
Klk1b11	A	G	7: 43,997,837	H65R	probably damaging	Het
Larp7	T	C	3: 127,537,036		probably null	Het
Ldlrad3	T	C	2: 102,113,547	D60G	possibly damaging	Het
Mlip	A	T	9: 77,190,381	H177Q	probably damaging	Het
Mrnip	A	G	11: 50,199,903	D298G	probably benign	Het
Npas2	A	C	1: 39,336,049	S483R	probably benign	Het
Nrg3	C	A	14: 39,012,000	E310*	probably null	Het
Olfr1382	T	A	11: 49,535,605	L140H	probably damaging	Het
Olfr504	G	T	7: 108,565,413	D127E	probably damaging	Het
Omg	T	A	11: 79,502,268	T255S	possibly damaging	Het
Plekhg6	T	C	6: 125,363,663	D578G	probably damaging	Het
Pygo1	A	G	9: 72,942,985	K39E	probably damaging	Het
Rell2	A	G	18: 37,956,941	D66G	probably damaging	Het
Samd9l	A	T	6: 3,375,446	I605K	probably damaging	Het
Sema6d	T	C	2: 124,664,050	S593P	probably damaging	Het
Sf3b3	A	G	8: 110,825,578	V545A	probably benign	Het
Speer4f1	T	A	5: 17,479,390		probably null	Het
Spem1	T	C	11: 69,821,148	E230G	possibly damaging	Het
Sphkap	A	G	1: 83,280,510	F171L	probably damaging	Het
Tbc1d13	T	C	2: 30,135,510		probably benign	Het
Tmem222	A	T	4: 133,266,843	N206K	probably benign	Het
Trnau1ap	C	T	4: 132,321,770	V41M	probably damaging	Het
Ttn	C	T	2: 76,939,043		probably null	Het
Ubr3	T	C	2: 69,936,024		probably null	Het
Vmn2r24	A	T	6: 123,779,001	I11F	possibly damaging	Het
Wasf2	T	C	4: 133,194,909		probably null	Het
Zbtb4	T	C	11: 69,778,628	S726P	possibly damaging	Het
Zfp534	C	T	4: 147,674,469	C581Y	probably damaging	Het
Zfp551	A	T	7: 12,417,181	C100*	probably null	Het

Other mutations in Uox

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00417:Uox	APN	3	146627810	missense	probably benign	0.00
IGL00902:Uox	APN	3	146610406	missense	possibly damaging	0.95
IGL02409:Uox	APN	3	146624626	missense	probably benign	0.06
IGL02827:Uox	APN	3	146597196	intron	probably benign
IGL02979:Uox	APN	3	146610491	splice site	probably null
IGL03375:Uox	APN	3	146625835	missense	probably damaging	1.00
kamloops	UTSW	3	146624577	nonsense	probably null
vancouver	UTSW	3	146612292	missense	probably damaging	1.00
R1350:Uox	UTSW	3	146624575	missense	probably damaging	1.00
R1634:Uox	UTSW	3	146612383	nonsense	probably null
R1900:Uox	UTSW	3	146610379	missense	probably damaging	1.00
R2000:Uox	UTSW	3	146610399	missense	possibly damaging	0.65
R2119:Uox	UTSW	3	146612542	missense	probably benign	0.01
R5329:Uox	UTSW	3	146624545	missense	probably damaging	1.00
R5606:Uox	UTSW	3	146610302	nonsense	probably null
R6281:Uox	UTSW	3	146624577	nonsense	probably null
R6327:Uox	UTSW	3	146624577	nonsense	probably null
R6337:Uox	UTSW	3	146624577	nonsense	probably null
R6364:Uox	UTSW	3	146624577	nonsense	probably null
R6365:Uox	UTSW	3	146624577	nonsense	probably null
R6369:Uox	UTSW	3	146624577	nonsense	probably null
R6483:Uox	UTSW	3	146624577	nonsense	probably null
R6492:Uox	UTSW	3	146624577	nonsense	probably null
R6494:Uox	UTSW	3	146624577	nonsense	probably null
R6556:Uox	UTSW	3	146624648	critical splice donor site	probably null
R7809:Uox	UTSW	3	146627858	nonsense	probably null
R7868:Uox	UTSW	3	146610274	missense	probably benign	0.01
R8131:Uox	UTSW	3	146625834	missense	probably damaging	1.00
R8931:Uox	UTSW	3	146612292	missense	probably damaging	1.00
R9088:Uox	UTSW	3	146624614	missense	probably damaging	1.00
R9566:Uox	UTSW	3	146624553	missense	possibly damaging	0.65

Predicted Primers

PCR Primer
(F):5'- CAGAAACATCGAGACCTTTGC -3'
(R):5'- AGAATTGCTTAGGGCCAAAAC -3'

Sequencing Primer
(F):5'- CGAGACCTTTGCAATGAACATCTG -3'
(R):5'- TTGCTTAGGGCCAAAACCAACAAG -3'

Posted On

2018-09-12