Incidental Mutation 'R6803:Vmn2r24'
ID533435
Institutional Source Beutler Lab
Gene Symbol Vmn2r24
Ensembl Gene ENSMUSG00000072780
Gene Namevomeronasal 2, receptor 24
SynonymsEG243628
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R6803 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location123778971-123816280 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 123779001 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 11 (I11F)
Ref Sequence ENSEMBL: ENSMUSP00000074602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075095]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075095
AA Change: I11F

PolyPhen 2 Score 0.645 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000074602
Gene: ENSMUSG00000072780
AA Change: I11F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 82 469 1.6e-32 PFAM
Pfam:NCD3G 518 571 1.1e-22 PFAM
Pfam:7tm_3 602 839 1.1e-54 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 98.0%
  • 20x: 94.7%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg9 A C 9: 50,789,560 D210A probably benign Het
As3mt T G 19: 46,709,581 M120R probably benign Het
Baz1a T A 12: 54,941,555 S270C probably null Het
Car5a A C 8: 121,923,765 probably null Het
Ccdc187 T A 2: 26,289,779 T223S probably benign Het
Cel T C 2: 28,558,048 N322S probably benign Het
Chd6 T C 2: 160,960,359 E2185G possibly damaging Het
Clcnkb T C 4: 141,405,328 T597A probably benign Het
Cntnap1 A G 11: 101,177,234 Y24C possibly damaging Het
Cog3 A G 14: 75,704,039 S817P probably benign Het
Col8a2 A G 4: 126,312,000 Y601C probably damaging Het
Cpm G T 10: 117,676,097 probably null Het
Cpt2 T C 4: 107,912,664 N79S probably damaging Het
Dnah17 T C 11: 118,125,372 T314A probably benign Het
Dnm1 C A 2: 32,312,754 V46F probably damaging Het
Fat3 C T 9: 15,996,787 V2640M probably damaging Het
Fbxl2 A T 9: 113,984,549 C296S probably damaging Het
Fcgbp A G 7: 28,103,212 T1522A probably benign Het
Foxl2 A C 9: 98,955,932 K91T probably damaging Het
Gm35339 A G 15: 76,356,576 Y488C probably damaging Het
Hdac11 G T 6: 91,166,265 R131L probably damaging Het
Ipo11 T C 13: 106,857,258 I723V probably benign Het
Klhl33 A G 14: 50,896,735 L150P probably damaging Het
Klk1b11 A G 7: 43,997,837 H65R probably damaging Het
Larp7 T C 3: 127,537,036 probably null Het
Ldlrad3 T C 2: 102,113,547 D60G possibly damaging Het
Mlip A T 9: 77,190,381 H177Q probably damaging Het
Mrnip A G 11: 50,199,903 D298G probably benign Het
Npas2 A C 1: 39,336,049 S483R probably benign Het
Nrg3 C A 14: 39,012,000 E310* probably null Het
Olfr1382 T A 11: 49,535,605 L140H probably damaging Het
Olfr504 G T 7: 108,565,413 D127E probably damaging Het
Omg T A 11: 79,502,268 T255S possibly damaging Het
Plekhg6 T C 6: 125,363,663 D578G probably damaging Het
Pygo1 A G 9: 72,942,985 K39E probably damaging Het
Rell2 A G 18: 37,956,941 D66G probably damaging Het
Samd9l A T 6: 3,375,446 I605K probably damaging Het
Sema6d T C 2: 124,664,050 S593P probably damaging Het
Sf3b3 A G 8: 110,825,578 V545A probably benign Het
Speer4f1 T A 5: 17,479,390 probably null Het
Spem1 T C 11: 69,821,148 E230G possibly damaging Het
Sphkap A G 1: 83,280,510 F171L probably damaging Het
Tbc1d13 T C 2: 30,135,510 probably benign Het
Tmem222 A T 4: 133,266,843 N206K probably benign Het
Trnau1ap C T 4: 132,321,770 V41M probably damaging Het
Ttn C T 2: 76,939,043 probably null Het
Ubr3 T C 2: 69,936,024 probably null Het
Uox T G 3: 146,612,509 V55G possibly damaging Het
Wasf2 T C 4: 133,194,909 probably null Het
Zbtb4 T C 11: 69,778,628 S726P possibly damaging Het
Zfp534 C T 4: 147,674,469 C581Y probably damaging Het
Zfp551 A T 7: 12,417,181 C100* probably null Het
Other mutations in Vmn2r24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Vmn2r24 APN 6 123815637 missense probably damaging 1.00
IGL01382:Vmn2r24 APN 6 123786979 missense possibly damaging 0.62
IGL01592:Vmn2r24 APN 6 123787486 missense probably benign 0.30
IGL01754:Vmn2r24 APN 6 123804161 missense probably damaging 1.00
IGL01939:Vmn2r24 APN 6 123787445 missense probably benign
IGL02140:Vmn2r24 APN 6 123780672 missense probably damaging 0.98
IGL02272:Vmn2r24 APN 6 123786884 missense possibly damaging 0.94
IGL02568:Vmn2r24 APN 6 123815853 missense probably benign 0.36
IGL02748:Vmn2r24 APN 6 123816098 missense possibly damaging 0.90
IGL03022:Vmn2r24 APN 6 123779008 missense probably damaging 0.99
IGL03343:Vmn2r24 APN 6 123816111 missense probably damaging 1.00
R0357:Vmn2r24 UTSW 6 123815410 frame shift probably null
R0453:Vmn2r24 UTSW 6 123780391 critical splice acceptor site probably null
R0538:Vmn2r24 UTSW 6 123816053 missense probably benign 0.32
R0607:Vmn2r24 UTSW 6 123786934 missense probably benign
R1381:Vmn2r24 UTSW 6 123786733 missense probably damaging 1.00
R1589:Vmn2r24 UTSW 6 123806520 splice site probably benign
R1848:Vmn2r24 UTSW 6 123816224 missense probably damaging 1.00
R2035:Vmn2r24 UTSW 6 123816060 missense probably damaging 1.00
R2077:Vmn2r24 UTSW 6 123815399 missense probably damaging 1.00
R2122:Vmn2r24 UTSW 6 123815394 missense possibly damaging 0.81
R2145:Vmn2r24 UTSW 6 123779013 missense probably benign
R2483:Vmn2r24 UTSW 6 123816038 missense probably damaging 1.00
R2512:Vmn2r24 UTSW 6 123787026 missense probably benign 0.01
R3001:Vmn2r24 UTSW 6 123804272 missense probably benign 0.00
R3002:Vmn2r24 UTSW 6 123804272 missense probably benign 0.00
R3236:Vmn2r24 UTSW 6 123779025 nonsense probably null
R3623:Vmn2r24 UTSW 6 123816038 missense probably damaging 1.00
R3624:Vmn2r24 UTSW 6 123816038 missense probably damaging 1.00
R3835:Vmn2r24 UTSW 6 123787453 missense probably benign 0.33
R4074:Vmn2r24 UTSW 6 123787415 missense possibly damaging 0.92
R4075:Vmn2r24 UTSW 6 123787415 missense possibly damaging 0.92
R4812:Vmn2r24 UTSW 6 123779185 missense probably benign 0.00
R4825:Vmn2r24 UTSW 6 123815780 missense probably benign 0.02
R5351:Vmn2r24 UTSW 6 123816264 missense possibly damaging 0.80
R5665:Vmn2r24 UTSW 6 123786979 missense possibly damaging 0.62
R5790:Vmn2r24 UTSW 6 123815540 missense probably benign
R5808:Vmn2r24 UTSW 6 123815638 nonsense probably null
R5879:Vmn2r24 UTSW 6 123787267 missense possibly damaging 0.89
R5923:Vmn2r24 UTSW 6 123815792 missense probably damaging 0.96
R5969:Vmn2r24 UTSW 6 123779022 missense probably benign 0.00
R6050:Vmn2r24 UTSW 6 123815732 missense probably damaging 1.00
R6171:Vmn2r24 UTSW 6 123787246 missense probably damaging 0.98
R6174:Vmn2r24 UTSW 6 123816277 missense probably benign 0.00
R6356:Vmn2r24 UTSW 6 123806409 missense possibly damaging 0.93
R6562:Vmn2r24 UTSW 6 123780427 missense probably benign 0.01
R6563:Vmn2r24 UTSW 6 123804178 missense possibly damaging 0.86
R6584:Vmn2r24 UTSW 6 123815805 missense possibly damaging 0.53
R6630:Vmn2r24 UTSW 6 123787022 missense probably benign 0.00
R6864:Vmn2r24 UTSW 6 123779158 missense possibly damaging 0.89
R7252:Vmn2r24 UTSW 6 123787232 missense possibly damaging 0.90
R7369:Vmn2r24 UTSW 6 123815679 missense probably damaging 0.99
R7646:Vmn2r24 UTSW 6 123816210 missense probably benign 0.20
R7799:Vmn2r24 UTSW 6 123780463 missense probably benign 0.00
R7803:Vmn2r24 UTSW 6 123780479 missense probably benign 0.00
R7959:Vmn2r24 UTSW 6 123778990 missense possibly damaging 0.86
R8215:Vmn2r24 UTSW 6 123779118 missense probably benign 0.10
R8796:Vmn2r24 UTSW 6 123780541 missense probably benign
RF006:Vmn2r24 UTSW 6 123806419 missense probably damaging 1.00
RF016:Vmn2r24 UTSW 6 123804215 missense probably benign 0.04
X0023:Vmn2r24 UTSW 6 123787400 missense probably damaging 0.99
Z1088:Vmn2r24 UTSW 6 123804196 missense probably benign 0.00
Z1177:Vmn2r24 UTSW 6 123786760 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACTGAGGGAGTGTTTGGATAC -3'
(R):5'- TGAACAACATCCAGTGTATCCG -3'

Sequencing Primer
(F):5'- ATACTGGTGGGCATGGATCAG -3'
(R):5'- ACAACATCCAGTGTATCCGTTTTATC -3'
Posted On2018-09-12