Incidental Mutation 'R6854:Rdh7'
ID535157
Institutional Source Beutler Lab
Gene Symbol Rdh7
Ensembl Gene ENSMUSG00000040134
Gene Nameretinol dehydrogenase 7
SynonymsCRAD2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R6854 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location127884028-127888817 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127888381 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 78 (E78G)
Ref Sequence ENSEMBL: ENSMUSP00000039252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047199]
Predicted Effect probably benign
Transcript: ENSMUST00000047199
AA Change: E78G

PolyPhen 2 Score 0.348 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000039252
Gene: ENSMUSG00000040134
AA Change: E78G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:adh_short 30 220 1.2e-40 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 9,015,235 S4628P probably damaging Het
Aspm G A 1: 139,463,182 R735H possibly damaging Het
Atp4a T C 7: 30,715,008 V152A probably benign Het
BC035947 G A 1: 78,498,488 T469I probably damaging Het
Bicra A T 7: 15,988,762 S277T probably benign Het
Catsperg1 A T 7: 29,181,702 N1142K possibly damaging Het
Ccnd3 T C 17: 47,578,720 probably benign Het
Cdc25a A G 9: 109,879,927 K79E probably damaging Het
Cfap44 A G 16: 44,449,028 probably null Het
Chd5 C A 4: 152,382,938 N1644K probably damaging Het
Flrt3 C T 2: 140,660,718 R330H probably damaging Het
Gm6034 T A 17: 36,057,218 probably null Het
Hivep1 A G 13: 42,156,507 E741G probably damaging Het
Iqgap3 T C 3: 88,096,951 V448A probably damaging Het
Itsn2 A G 12: 4,652,382 R679G probably benign Het
Klrb1c A G 6: 128,788,418 S70P possibly damaging Het
Maml2 C T 9: 13,705,835 T159I possibly damaging Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Mycl G A 4: 123,000,246 D280N probably damaging Het
Nlrp1b G A 11: 71,228,433 T12I possibly damaging Het
Olfr1315-ps1 T C 2: 112,110,647 N202D probably benign Het
Olfr187 A C 16: 59,036,065 I224S possibly damaging Het
Palmd A G 3: 116,923,463 S462P probably benign Het
Phyhd1 A C 2: 30,269,761 I36L possibly damaging Het
Plcd1 T C 9: 119,074,321 probably null Het
Pml G C 9: 58,219,906 A806G probably damaging Het
Ppp6r1 C A 7: 4,632,396 A838S probably benign Het
Pqlc3 G A 12: 16,999,829 L43F probably damaging Het
Prkdc C T 16: 15,651,538 T169I probably damaging Het
Prr23a1 G T 9: 98,842,935 V117L possibly damaging Het
Pus7 T C 5: 23,768,847 silent Het
Repin1 G T 6: 48,593,891 probably benign Het
Rptn A G 3: 93,398,123 N921S possibly damaging Het
Sema4f A G 6: 82,918,002 L404P probably damaging Het
Serinc4 T A 2: 121,456,550 M2L probably benign Het
Siglecf T C 7: 43,352,180 V138A probably benign Het
Speer2 T A 16: 69,858,887 Q106L probably damaging Het
Sptb G A 12: 76,603,480 P1821L probably damaging Het
St3gal3 C A 4: 117,958,530 M107I probably benign Het
Tmem25 T C 9: 44,796,008 K265E possibly damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Vsig10 G A 5: 117,338,407 V309I probably benign Het
Zfp318 G GAAGAAA 17: 46,412,542 probably benign Het
Other mutations in Rdh7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02098:Rdh7 APN 10 127884738 missense probably benign
IGL02727:Rdh7 APN 10 127887618 missense probably damaging 1.00
IGL03211:Rdh7 APN 10 127887623 missense probably benign 0.01
R0315:Rdh7 UTSW 10 127888396 missense possibly damaging 0.67
R0394:Rdh7 UTSW 10 127884670 missense probably benign 0.03
R0669:Rdh7 UTSW 10 127884729 missense probably benign
R1662:Rdh7 UTSW 10 127888612 start codon destroyed probably null 1.00
R1735:Rdh7 UTSW 10 127884585 missense probably benign 0.00
R1778:Rdh7 UTSW 10 127884721 missense probably benign 0.03
R2191:Rdh7 UTSW 10 127888598 missense probably benign 0.04
R2268:Rdh7 UTSW 10 127884661 missense probably benign 0.01
R4240:Rdh7 UTSW 10 127885802 missense probably benign 0.00
R4817:Rdh7 UTSW 10 127885762 missense probably benign
R4887:Rdh7 UTSW 10 127885721 missense probably benign 0.00
R4970:Rdh7 UTSW 10 127885822 missense probably benign 0.00
R6463:Rdh7 UTSW 10 127885781 missense probably benign 0.33
R6615:Rdh7 UTSW 10 127884622 missense probably damaging 0.98
R6835:Rdh7 UTSW 10 127884739 missense probably benign
R7172:Rdh7 UTSW 10 127888349 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGAGTACTCAGGTGATGTGCTG -3'
(R):5'- TCTACCTGGTTGCACTGGTG -3'

Sequencing Primer
(F):5'- TTACTTCAGGGCCCCCAAG -3'
(R):5'- CTGCGCTTCTTCAGGGAGAG -3'
Posted On2018-09-12