Incidental Mutation 'R6854:Tmem25'
ID535152
Institutional Source Beutler Lab
Gene Symbol Tmem25
Ensembl Gene ENSMUSG00000002032
Gene Nametransmembrane protein 25
Synonyms0610039J01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R6854 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location44793769-44799307 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44796008 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 265 (K265E)
Ref Sequence ENSEMBL: ENSMUSP00000002100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002099] [ENSMUST00000002100] [ENSMUST00000044694] [ENSMUST00000114705] [ENSMUST00000132020] [ENSMUST00000213203] [ENSMUST00000213363] [ENSMUST00000213972] [ENSMUST00000214431] [ENSMUST00000214833]
Predicted Effect probably benign
Transcript: ENSMUST00000002099
SMART Domains Protein: ENSMUSP00000002099
Gene: ENSMUSG00000002031

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
low complexity region 29 52 N/A INTRINSIC
Pfam:IFT46_B_C 60 270 6.2e-106 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000002100
AA Change: K265E

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000002100
Gene: ENSMUSG00000002032
AA Change: K265E

DomainStartEndE-ValueType
low complexity region 5 23 N/A INTRINSIC
Pfam:C2-set_2 26 118 2.7e-14 PFAM
SCOP:d1ie5a_ 121 220 2e-6 SMART
transmembrane domain 238 260 N/A INTRINSIC
low complexity region 327 338 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000044694
SMART Domains Protein: ENSMUSP00000042183
Gene: ENSMUSG00000039438

DomainStartEndE-ValueType
low complexity region 22 39 N/A INTRINSIC
Pfam:TPR_11 46 112 2.1e-13 PFAM
Pfam:TPR_9 54 123 5.8e-7 PFAM
Pfam:TPR_1 82 113 2.3e-6 PFAM
Pfam:TPR_2 82 114 1.2e-5 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114705
SMART Domains Protein: ENSMUSP00000110353
Gene: ENSMUSG00000002032

DomainStartEndE-ValueType
low complexity region 5 23 N/A INTRINSIC
Pfam:C2-set_2 26 118 2.2e-15 PFAM
SCOP:d1ie5a_ 121 220 2e-6 SMART
transmembrane domain 238 260 N/A INTRINSIC
low complexity region 327 338 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132020
Predicted Effect probably benign
Transcript: ENSMUST00000213203
AA Change: K265E

PolyPhen 2 Score 0.307 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000213363
Predicted Effect probably benign
Transcript: ENSMUST00000213972
Predicted Effect probably benign
Transcript: ENSMUST00000214431
Predicted Effect probably benign
Transcript: ENSMUST00000214833
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (44/44)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 9,015,235 S4628P probably damaging Het
Aspm G A 1: 139,463,182 R735H possibly damaging Het
Atp4a T C 7: 30,715,008 V152A probably benign Het
BC035947 G A 1: 78,498,488 T469I probably damaging Het
Bicra A T 7: 15,988,762 S277T probably benign Het
Catsperg1 A T 7: 29,181,702 N1142K possibly damaging Het
Ccnd3 T C 17: 47,578,720 probably benign Het
Cdc25a A G 9: 109,879,927 K79E probably damaging Het
Cfap44 A G 16: 44,449,028 probably null Het
Chd5 C A 4: 152,382,938 N1644K probably damaging Het
Flrt3 C T 2: 140,660,718 R330H probably damaging Het
Gm6034 T A 17: 36,057,218 probably null Het
Hivep1 A G 13: 42,156,507 E741G probably damaging Het
Iqgap3 T C 3: 88,096,951 V448A probably damaging Het
Itsn2 A G 12: 4,652,382 R679G probably benign Het
Klrb1c A G 6: 128,788,418 S70P possibly damaging Het
Maml2 C T 9: 13,705,835 T159I possibly damaging Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Mycl G A 4: 123,000,246 D280N probably damaging Het
Nlrp1b G A 11: 71,228,433 T12I possibly damaging Het
Olfr1315-ps1 T C 2: 112,110,647 N202D probably benign Het
Olfr187 A C 16: 59,036,065 I224S possibly damaging Het
Palmd A G 3: 116,923,463 S462P probably benign Het
Phyhd1 A C 2: 30,269,761 I36L possibly damaging Het
Plcd1 T C 9: 119,074,321 probably null Het
Pml G C 9: 58,219,906 A806G probably damaging Het
Ppp6r1 C A 7: 4,632,396 A838S probably benign Het
Pqlc3 G A 12: 16,999,829 L43F probably damaging Het
Prkdc C T 16: 15,651,538 T169I probably damaging Het
Prr23a1 G T 9: 98,842,935 V117L possibly damaging Het
Pus7 T C 5: 23,768,847 silent Het
Rdh7 T C 10: 127,888,381 E78G probably benign Het
Repin1 G T 6: 48,593,891 probably benign Het
Rptn A G 3: 93,398,123 N921S possibly damaging Het
Sema4f A G 6: 82,918,002 L404P probably damaging Het
Serinc4 T A 2: 121,456,550 M2L probably benign Het
Siglecf T C 7: 43,352,180 V138A probably benign Het
Speer2 T A 16: 69,858,887 Q106L probably damaging Het
Sptb G A 12: 76,603,480 P1821L probably damaging Het
St3gal3 C A 4: 117,958,530 M107I probably benign Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Vsig10 G A 5: 117,338,407 V309I probably benign Het
Zfp318 G GAAGAAA 17: 46,412,542 probably benign Het
Other mutations in Tmem25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00596:Tmem25 APN 9 44795519 unclassified probably benign
IGL01980:Tmem25 APN 9 44798271 nonsense probably null
IGL02000:Tmem25 APN 9 44798271 nonsense probably null
IGL03407:Tmem25 APN 9 44796339 missense probably damaging 1.00
R0446:Tmem25 UTSW 9 44796581 missense probably damaging 1.00
R0690:Tmem25 UTSW 9 44795514 unclassified probably benign
R0960:Tmem25 UTSW 9 44795512 critical splice acceptor site probably null
R1204:Tmem25 UTSW 9 44795232 missense probably benign 0.17
R1899:Tmem25 UTSW 9 44798216 unclassified probably null
R1927:Tmem25 UTSW 9 44796483 missense possibly damaging 0.77
R2088:Tmem25 UTSW 9 44796086 missense possibly damaging 0.94
R3027:Tmem25 UTSW 9 44798214 unclassified probably null
R7305:Tmem25 UTSW 9 44795408 critical splice donor site probably null
R7655:Tmem25 UTSW 9 44798343 missense possibly damaging 0.82
R7656:Tmem25 UTSW 9 44798343 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- ACCCGAGATCACTTTCCAGC -3'
(R):5'- TGTGAATGAGTTATCCCCAGC -3'

Sequencing Primer
(F):5'- AGATCACTTTCCAGCGCCCG -3'
(R):5'- CATGTGGCATGTCAGGGTCAG -3'
Posted On2018-09-12