Incidental Mutation 'R6854:Ccnd3'
ID535168
Institutional Source Beutler Lab
Gene Symbol Ccnd3
Ensembl Gene ENSMUSG00000034165
Gene Namecyclin D3
Synonyms9230106B05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6854 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location47505051-47599691 bp(+) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) T to C at 47578720 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037333] [ENSMUST00000171031] [ENSMUST00000182129] [ENSMUST00000182506] [ENSMUST00000182848] [ENSMUST00000182935] [ENSMUST00000183044] [ENSMUST00000183177] [ENSMUST00000183210]
Predicted Effect probably benign
Transcript: ENSMUST00000037333
SMART Domains Protein: ENSMUSP00000040488
Gene: ENSMUSG00000034165

DomainStartEndE-ValueType
CYCLIN 62 146 1.12e-17 SMART
Cyclin_C 155 280 3.49e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171031
SMART Domains Protein: ENSMUSP00000126141
Gene: ENSMUSG00000034165

DomainStartEndE-ValueType
CYCLIN 62 146 1.12e-17 SMART
Cyclin_C 155 280 3.49e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182129
SMART Domains Protein: ENSMUSP00000138486
Gene: ENSMUSG00000034165

DomainStartEndE-ValueType
CYCLIN 62 146 1.12e-17 SMART
Pfam:Cyclin_C 155 214 2.6e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182506
SMART Domains Protein: ENSMUSP00000138180
Gene: ENSMUSG00000034165

DomainStartEndE-ValueType
CYCLIN 62 146 1.12e-17 SMART
Cyclin_C 155 251 2.02e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182848
SMART Domains Protein: ENSMUSP00000138715
Gene: ENSMUSG00000034165

DomainStartEndE-ValueType
CYCLIN 62 146 1.12e-17 SMART
Pfam:Cyclin_C 155 243 8.1e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182935
Predicted Effect probably benign
Transcript: ENSMUST00000183044
SMART Domains Protein: ENSMUSP00000138220
Gene: ENSMUSG00000034165

DomainStartEndE-ValueType
CYCLIN 62 146 1.12e-17 SMART
Cyclin_C 155 280 3.49e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183177
SMART Domains Protein: ENSMUSP00000138640
Gene: ENSMUSG00000034165

DomainStartEndE-ValueType
CYCLIN 62 146 1.12e-17 SMART
Cyclin_C 155 280 3.49e-16 SMART
Predicted Effect unknown
Transcript: ENSMUST00000183210
AA Change: S20P
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with and functions as a regulatory subunit of CDK4 or CDK6, whose activtiy is required for cell cycle G1/S transition. This protein has been shown to interact with and be involved in the phosphorylation of tumor suppressor protein Rb. The CDK4 activity associated with this cyclin was reported to be necessary for cell cycle progression through G2 phase into mitosis after UV radiation. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit severe thymus hypoplasia, abnormal thymocyte development, and impaired expansion of immature T lymphocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak T C 19: 9,015,235 S4628P probably damaging Het
Aspm G A 1: 139,463,182 R735H possibly damaging Het
Atp4a T C 7: 30,715,008 V152A probably benign Het
BC035947 G A 1: 78,498,488 T469I probably damaging Het
Bicra A T 7: 15,988,762 S277T probably benign Het
Catsperg1 A T 7: 29,181,702 N1142K possibly damaging Het
Cdc25a A G 9: 109,879,927 K79E probably damaging Het
Cfap44 A G 16: 44,449,028 probably null Het
Chd5 C A 4: 152,382,938 N1644K probably damaging Het
Flrt3 C T 2: 140,660,718 R330H probably damaging Het
Gm6034 T A 17: 36,057,218 probably null Het
Hivep1 A G 13: 42,156,507 E741G probably damaging Het
Iqgap3 T C 3: 88,096,951 V448A probably damaging Het
Itsn2 A G 12: 4,652,382 R679G probably benign Het
Klrb1c A G 6: 128,788,418 S70P possibly damaging Het
Maml2 C T 9: 13,705,835 T159I possibly damaging Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Mycl G A 4: 123,000,246 D280N probably damaging Het
Nlrp1b G A 11: 71,228,433 T12I possibly damaging Het
Olfr1315-ps1 T C 2: 112,110,647 N202D probably benign Het
Olfr187 A C 16: 59,036,065 I224S possibly damaging Het
Palmd A G 3: 116,923,463 S462P probably benign Het
Phyhd1 A C 2: 30,269,761 I36L possibly damaging Het
Plcd1 T C 9: 119,074,321 probably null Het
Pml G C 9: 58,219,906 A806G probably damaging Het
Ppp6r1 C A 7: 4,632,396 A838S probably benign Het
Pqlc3 G A 12: 16,999,829 L43F probably damaging Het
Prkdc C T 16: 15,651,538 T169I probably damaging Het
Prr23a1 G T 9: 98,842,935 V117L possibly damaging Het
Pus7 T C 5: 23,768,847 silent Het
Rdh7 T C 10: 127,888,381 E78G probably benign Het
Repin1 G T 6: 48,593,891 probably benign Het
Rptn A G 3: 93,398,123 N921S possibly damaging Het
Sema4f A G 6: 82,918,002 L404P probably damaging Het
Serinc4 T A 2: 121,456,550 M2L probably benign Het
Siglecf T C 7: 43,352,180 V138A probably benign Het
Speer2 T A 16: 69,858,887 Q106L probably damaging Het
Sptb G A 12: 76,603,480 P1821L probably damaging Het
St3gal3 C A 4: 117,958,530 M107I probably benign Het
Tmem25 T C 9: 44,796,008 K265E possibly damaging Het
Ttll3 CAAAGTAA CAAAGTAAAGTAA 6: 113,399,157 probably null Het
Vsig10 G A 5: 117,338,407 V309I probably benign Het
Zfp318 G GAAGAAA 17: 46,412,542 probably benign Het
Other mutations in Ccnd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01073:Ccnd3 APN 17 47594845 missense probably benign
R1494:Ccnd3 UTSW 17 47598108 unclassified probably null
R4812:Ccnd3 UTSW 17 47597580 critical splice donor site probably null
R5589:Ccnd3 UTSW 17 47598619 missense probably damaging 1.00
R6250:Ccnd3 UTSW 17 47597562 nonsense probably null
R6381:Ccnd3 UTSW 17 47505224 utr 5 prime probably benign
R7695:Ccnd3 UTSW 17 47597496 missense probably damaging 1.00
X0050:Ccnd3 UTSW 17 47593680 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TGGGGAATCACCTGAGCATC -3'
(R):5'- CAAGGCCATCAGATTAATCTCTCAG -3'

Sequencing Primer
(F):5'- ACCTGAGCATCCATCTTGAGG -3'
(R):5'- TCAGATTAATCTCTCAGTGACACC -3'
Posted On2018-09-12