Incidental Mutation 'R6866:Cnga4'
ID535926
Institutional Source Beutler Lab
Gene Symbol Cnga4
Ensembl Gene ENSMUSG00000030897
Gene Namecyclic nucleotide gated channel alpha 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R6866 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location105404568-105408742 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105407745 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 352 (S352G)
Ref Sequence ENSEMBL: ENSMUSP00000147387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033187] [ENSMUST00000210344]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033187
AA Change: S455G

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000033187
Gene: ENSMUSG00000030897
AA Change: S455G

DomainStartEndE-ValueType
Pfam:Ion_trans 34 276 1.1e-28 PFAM
cNMP 348 472 1.54e-25 SMART
low complexity region 500 508 N/A INTRINSIC
low complexity region 514 523 N/A INTRINSIC
low complexity region 540 557 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000210344
AA Change: S352G

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CNGA4 is a modulatory subunit of vertebrate cyclic nucleotide-gated membrane channels that transduce odorant signals (Munger et al., 2001 [PubMed 11739959]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Inactivation of this gene results in odor adaptation defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700021F05Rik ACTGCACCACCT ACT 10: 43,532,725 probably benign Het
Alms1 A G 6: 85,621,098 T1438A possibly damaging Het
Als2 T A 1: 59,211,133 Q484L probably damaging Het
Apeh G A 9: 108,092,679 H186Y probably damaging Het
BC051142 T A 17: 34,459,961 C216S possibly damaging Het
Bcl2l13 T A 6: 120,862,889 N49K probably benign Het
Bptf T C 11: 107,073,580 D1596G probably damaging Het
Brsk1 T C 7: 4,706,407 M325T probably damaging Het
C87499 T A 4: 88,627,740 D455V probably damaging Het
Caly T C 7: 140,070,619 M137V probably benign Het
Cdca2 T C 14: 67,693,666 E526G possibly damaging Het
Cntnap5c A C 17: 58,092,294 T381P probably benign Het
Cr2 T A 1: 195,151,691 Y633F probably damaging Het
Cryba1 T C 11: 77,719,529 N120S probably benign Het
Cyfip2 G A 11: 46,242,459 R805* probably null Het
Dnah7c C A 1: 46,657,243 P2095Q probably damaging Het
Eif3k T C 7: 28,977,226 E110G possibly damaging Het
Extl2 A G 3: 116,027,352 M283V probably damaging Het
Extl2 T A 3: 116,027,353 M283K probably damaging Het
Focad T C 4: 88,403,386 I1658T probably benign Het
Fstl5 A T 3: 76,322,225 H111L probably damaging Het
Garnl3 A G 2: 33,002,773 probably null Het
Gm3633 T A 14: 42,640,622 probably benign Het
Il4i1 T A 7: 44,836,539 probably null Het
Kcnj6 A T 16: 94,762,677 C321S probably damaging Het
Kif20a A T 18: 34,628,493 Y313F probably benign Het
Kmt2d T G 15: 98,857,393 probably benign Het
Kynu T A 2: 43,563,110 Y48* probably null Het
Ly9 T C 1: 171,605,279 I55M probably damaging Het
Mgme1 T C 2: 144,276,519 V237A probably damaging Het
Mmp16 T A 4: 17,853,800 L27H probably benign Het
Myh1 A C 11: 67,224,393 D1918A probably damaging Het
Myo5a G A 9: 75,140,688 C266Y probably damaging Het
Nckap5l A G 15: 99,426,468 I718T probably benign Het
Nptx1 A G 11: 119,546,650 probably null Het
Olfr180 A G 16: 58,915,988 Y218H probably damaging Het
Olfr502 A G 7: 108,523,170 F260S probably damaging Het
Olfr682-ps1 T A 7: 105,126,618 M228L probably benign Het
Phc3 T A 3: 30,914,531 K783* probably null Het
Pkdrej A T 15: 85,820,881 C285S probably damaging Het
Pot1b T A 17: 55,653,474 T619S possibly damaging Het
Psg21 A T 7: 18,652,284 V259E probably damaging Het
Pvr A C 7: 19,918,630 I120S probably benign Het
Rbm17 T G 2: 11,598,090 I68L probably benign Het
Rnf138 C T 18: 21,002,142 P28L probably damaging Het
Rnf207 C T 4: 152,312,532 C385Y possibly damaging Het
Serping1 A C 2: 84,770,233 V255G probably benign Het
Slc25a3 A T 10: 91,119,705 V91E probably damaging Het
Slc26a8 T C 17: 28,638,481 D896G probably benign Het
Slc27a5 T A 7: 12,997,516 T183S probably benign Het
Slc33a1 A T 3: 63,943,323 F527I probably benign Het
Strn4 A T 7: 16,828,785 D283V probably damaging Het
Sult1e1 G A 5: 87,586,766 T107I probably damaging Het
Tango6 G A 8: 106,742,472 probably null Het
Tecrl G T 5: 83,313,314 P99T probably damaging Het
Ticrr T C 7: 79,693,957 L1190P possibly damaging Het
Timm50 C T 7: 28,305,945 R349H probably damaging Het
Tjp2 A G 19: 24,101,991 I840T probably damaging Het
Tmem173 T C 18: 35,739,429 H50R probably damaging Het
Tmem45a2 T A 16: 57,047,023 N105I probably damaging Het
Zfp148 T A 16: 33,468,126 C162S probably damaging Het
Zfp534 T C 4: 147,674,481 K577R probably benign Het
Other mutations in Cnga4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Cnga4 APN 7 105404962 missense probably benign
IGL01418:Cnga4 APN 7 105404962 missense probably benign
IGL02450:Cnga4 APN 7 105405748 missense probably damaging 1.00
IGL02533:Cnga4 APN 7 105407961 missense probably damaging 0.97
IGL03052:Cnga4 UTSW 7 105404725 missense probably benign 0.21
R0020:Cnga4 UTSW 7 105405677 missense probably damaging 1.00
R0135:Cnga4 UTSW 7 105406848 missense probably damaging 1.00
R0281:Cnga4 UTSW 7 105407668 missense probably damaging 1.00
R0506:Cnga4 UTSW 7 105407740 missense probably damaging 1.00
R0599:Cnga4 UTSW 7 105405818 missense probably damaging 1.00
R0646:Cnga4 UTSW 7 105404975 missense possibly damaging 0.47
R0980:Cnga4 UTSW 7 105408006 missense probably damaging 1.00
R1727:Cnga4 UTSW 7 105405754 missense probably damaging 1.00
R3415:Cnga4 UTSW 7 105407118 missense probably damaging 1.00
R3768:Cnga4 UTSW 7 105407680 missense probably damaging 1.00
R4559:Cnga4 UTSW 7 105405685 missense probably damaging 1.00
R4852:Cnga4 UTSW 7 105405730 missense probably benign 0.01
R5081:Cnga4 UTSW 7 105407025 missense probably benign 0.20
R6232:Cnga4 UTSW 7 105407699 nonsense probably null
R6234:Cnga4 UTSW 7 105407699 nonsense probably null
R6235:Cnga4 UTSW 7 105407699 nonsense probably null
R6824:Cnga4 UTSW 7 105406829 missense probably benign
R6997:Cnga4 UTSW 7 105406983 missense probably damaging 1.00
R7019:Cnga4 UTSW 7 105405829 missense probably benign 0.00
R7273:Cnga4 UTSW 7 105406965 missense probably damaging 1.00
R7509:Cnga4 UTSW 7 105406890 missense probably benign 0.32
R7522:Cnga4 UTSW 7 105405988 missense probably damaging 0.99
R7545:Cnga4 UTSW 7 105407079 missense probably damaging 1.00
R7873:Cnga4 UTSW 7 105407042 missense probably damaging 0.99
R7956:Cnga4 UTSW 7 105407042 missense probably damaging 0.99
R8024:Cnga4 UTSW 7 105406835 missense probably damaging 1.00
X0025:Cnga4 UTSW 7 105405220 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGGAGTGAAATGTGACCTTCC -3'
(R):5'- GCGGTAAGCTATCTTCAGTGC -3'

Sequencing Primer
(F):5'- GAGTGAAATGTGACCTTCCTGTCTTC -3'
(R):5'- TAAGCTATCTTCAGTGCGCTGGAC -3'
Posted On2018-10-18