Incidental Mutation 'R6820:Pak1'
ID537566
Institutional Source Beutler Lab
Gene Symbol Pak1
Ensembl Gene ENSMUSG00000030774
Gene Namep21 (RAC1) activated kinase 1
SynonymsPaka, PAK-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6820 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location97788541-97912381 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97886379 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 226 (N226D)
Ref Sequence ENSEMBL: ENSMUSP00000146055 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033040] [ENSMUST00000156637] [ENSMUST00000206984]
Predicted Effect probably benign
Transcript: ENSMUST00000033040
AA Change: N226D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000033040
Gene: ENSMUSG00000030774
AA Change: N226D

DomainStartEndE-ValueType
low complexity region 39 51 N/A INTRINSIC
PBD 75 110 3.92e-16 SMART
low complexity region 168 191 N/A INTRINSIC
S_TKc 269 520 7.19e-98 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156637
SMART Domains Protein: ENSMUSP00000138684
Gene: ENSMUSG00000030774

DomainStartEndE-ValueType
low complexity region 39 51 N/A INTRINSIC
PBD 75 110 3.92e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000206984
AA Change: N226D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a family member of serine/threonine p21-activating kinases, known as PAK proteins. These proteins are critical effectors that link RhoGTPases to cytoskeleton reorganization and nuclear signaling, and they serve as targets for the small GTP binding proteins Cdc42 and Rac. This specific family member regulates cell motility and morphology. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele display defects in allergen-induced mast cell migration and degranulation. Mice homozygous for a different knock-out allele exhibit reduced long term potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Accs T A 2: 93,842,921 N141Y probably null Het
Chkb A G 15: 89,428,176 L46P probably damaging Het
Col9a3 G A 2: 180,607,134 V260M probably damaging Het
Dna2 T C 10: 62,964,904 I739T possibly damaging Het
Dnah17 T C 11: 118,069,000 H2620R probably damaging Het
Dsel A G 1: 111,859,817 V996A probably damaging Het
Dst T C 1: 34,211,256 L1757S probably damaging Het
Exoc5 A T 14: 49,048,930 probably null Het
Fam120a A T 13: 48,880,992 V1048E possibly damaging Het
Fam213b A T 4: 154,898,166 D50E probably damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fbxw19 T A 9: 109,482,011 T377S probably benign Het
Fbxw28 A T 9: 109,338,425 F88Y probably damaging Het
Grik5 C T 7: 25,046,355 R431Q possibly damaging Het
Gtsf1 T C 15: 103,420,527 T92A probably benign Het
Hoxc13 A G 15: 102,921,822 Y212C probably damaging Het
Itih2 T C 2: 10,098,098 I742V probably benign Het
Kat7 T C 11: 95,284,139 T351A probably damaging Het
Mlh3 T C 12: 85,247,723 D1233G probably damaging Het
Mroh2b A G 15: 4,953,274 D1525G probably damaging Het
Nme5 T C 18: 34,571,573 Y73C probably damaging Het
Nr3c2 T C 8: 77,242,457 V957A probably damaging Het
Nup153 A G 13: 46,709,983 S301P probably benign Het
Obscn T C 11: 59,051,193 D5013G probably damaging Het
Olfr1278 C T 2: 111,293,110 P281S probably damaging Het
Olfr470 A G 7: 107,845,091 V214A probably benign Het
Olfr919 A G 9: 38,697,475 V297A possibly damaging Het
Pak4 A G 7: 28,563,036 Y384H probably benign Het
Pkp3 T C 7: 141,079,844 probably null Het
Psd G T 19: 46,320,844 A558E probably damaging Het
Psmd14 C A 2: 61,776,724 H172N probably benign Het
Pygb G T 2: 150,816,754 W366L possibly damaging Het
Rbm39 A T 2: 156,179,226 M1K probably null Het
Rnf213 T C 11: 119,448,838 I3421T probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Smg6 T C 11: 75,041,964 V88A probably damaging Het
Tha1 T C 11: 117,871,678 E80G probably benign Het
Tie1 A G 4: 118,484,386 V243A probably damaging Het
Tmem215 T C 4: 40,473,926 M1T probably null Het
Tpm2 A G 4: 43,518,443 Y221H probably damaging Het
Ubap1 C T 4: 41,379,854 P356L probably benign Het
Wbp2nl G T 15: 82,313,795 A178S possibly damaging Het
Wdr54 A T 6: 83,154,619 S139T probably benign Het
Wipi2 G C 5: 142,629,800 Q14H probably benign Het
Zan T C 5: 137,407,844 probably benign Het
Zfp735 A G 11: 73,688,957 M1V probably null Het
Other mutations in Pak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Pak1 APN 7 97854568 missense probably benign 0.03
IGL01676:Pak1 APN 7 97883531 missense probably benign 0.00
IGL02058:Pak1 APN 7 97911115 missense probably damaging 1.00
IGL02557:Pak1 APN 7 97871587 missense probably benign 0.08
IGL02678:Pak1 APN 7 97894002 missense probably damaging 0.99
R1739:Pak1 UTSW 7 97904695 missense probably damaging 1.00
R1874:Pak1 UTSW 7 97871580 missense probably benign 0.23
R2057:Pak1 UTSW 7 97907797 splice site probably null
R2363:Pak1 UTSW 7 97886314 missense probably benign 0.01
R2420:Pak1 UTSW 7 97854479 missense probably benign 0.02
R2880:Pak1 UTSW 7 97904811 missense probably damaging 1.00
R3113:Pak1 UTSW 7 97866114 nonsense probably null
R3722:Pak1 UTSW 7 97854497 missense probably damaging 1.00
R4363:Pak1 UTSW 7 97883586 missense possibly damaging 0.49
R6021:Pak1 UTSW 7 97854463 missense probably damaging 1.00
R6459:Pak1 UTSW 7 97907881 missense probably benign 0.04
R7336:Pak1 UTSW 7 97888972 missense probably benign 0.13
R7717:Pak1 UTSW 7 97886348 missense probably benign 0.00
X0027:Pak1 UTSW 7 97904752 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGATTTTGGCCTTGAAGAGAAGG -3'
(R):5'- GGAGCATTCAGATCTTTATTGTAGC -3'

Sequencing Primer
(F):5'- TTTGGCCTTGAAGAGAAGGGATGAG -3'
(R):5'- GCACTCCATCTCAATGATTAATCAGG -3'
Posted On2018-10-18