Incidental Mutation 'R6918:Pomt1'
ID539428
Institutional Source Beutler Lab
Gene Symbol Pomt1
Ensembl Gene ENSMUSG00000039254
Gene Nameprotein-O-mannosyltransferase 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R6918 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location32236590-32255005 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 32252861 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000038722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002625] [ENSMUST00000036473]
Predicted Effect probably benign
Transcript: ENSMUST00000002625
SMART Domains Protein: ENSMUSP00000002625
Gene: ENSMUSG00000002550

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
Pfam:CoaE 30 198 1.1e-8 PFAM
Pfam:AAA_17 31 188 3.8e-8 PFAM
Pfam:PRK 31 225 1.9e-53 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000036473
SMART Domains Protein: ENSMUSP00000038722
Gene: ENSMUSG00000039254

DomainStartEndE-ValueType
Pfam:PMT 42 289 2.8e-96 PFAM
MIR 318 381 7.45e-8 SMART
MIR 392 449 1.65e-9 SMART
MIR 456 513 6.2e-5 SMART
Pfam:PMT_4TMC 542 740 3.9e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132516
Predicted Effect probably benign
Transcript: ENSMUST00000138133
SMART Domains Protein: ENSMUSP00000125350
Gene: ENSMUSG00000002550

DomainStartEndE-ValueType
Pfam:PRK 1 151 1e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192998
Meta Mutation Damage Score 0.6468 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an O-mannosyltransferase that requires interaction with the product of the POMT2 gene for enzymatic function. The encoded protein is found in the membrane of the endoplasmic reticulum. Defects in this gene are a cause of Walker-Warburg syndrome (WWS) and limb-girdle muscular dystrophy type 2K (LGMD2K). Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutation of this gene with one allele results in embryonic lethality with disruption of Reichert's membrane. Heterozygous mutation with a second allele results in ectasia in kidney and liver veins and an increased neutrophil count. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210011C24Rik T G 8: 84,011,684 M1L probably benign Het
Abca3 A C 17: 24,408,658 K1359Q probably damaging Het
Ace T C 11: 105,972,943 Y406H probably damaging Het
Acsl6 A G 11: 54,341,756 probably null Het
Alms1 T A 6: 85,622,661 Y1959N possibly damaging Het
BC037034 A G 5: 138,260,664 V211A probably benign Het
Chrna7 T A 7: 63,159,551 I76F probably benign Het
Cuedc1 C T 11: 88,187,073 T296I probably benign Het
Ddc A G 11: 11,819,307 V409A probably damaging Het
Dhx8 T A 11: 101,738,421 Y212* probably null Het
Dnah6 T A 6: 73,181,755 K622* probably null Het
Dscaml1 A G 9: 45,430,507 H72R probably benign Het
Dyrk1b A G 7: 28,185,925 D396G probably damaging Het
Gstm2 A G 3: 107,985,241 probably null Het
Hsd3b1 A G 3: 98,853,109 Y189H probably damaging Het
Kif1c G A 11: 70,706,987 E356K probably damaging Het
Kirrel2 A C 7: 30,450,814 C17G probably damaging Het
Klhl12 A G 1: 134,475,846 H259R possibly damaging Het
Krt1 A G 15: 101,850,177 V184A probably damaging Het
Lmod2 A T 6: 24,603,595 N190Y probably benign Het
Lrp2 A C 2: 69,489,305 V1958G probably damaging Het
Ly6h T C 15: 75,565,658 S37G probably damaging Het
Man2a2 A T 7: 80,353,192 H1056Q possibly damaging Het
Mixl1 T A 1: 180,694,678 I213F probably benign Het
Morc3 T C 16: 93,853,135 I268T probably benign Het
Mtx2 C T 2: 74,876,353 T224I probably damaging Het
Olfr893 G A 9: 38,209,652 V198M possibly damaging Het
Oscp1 A C 4: 126,076,778 D120A possibly damaging Het
Parp1 G A 1: 180,588,670 V545I possibly damaging Het
Pipox A G 11: 77,881,554 I330T probably damaging Het
Pkp2 A G 16: 16,272,218 Y790C probably damaging Het
Pp2d1 G A 17: 53,515,459 T193M probably damaging Het
Prkra G T 2: 76,630,453 H300Q probably damaging Het
Ror2 T G 13: 53,111,451 N523T probably damaging Het
Rp1 A T 1: 3,999,608 D1355E unknown Het
Rsph4a T C 10: 33,905,276 Y41H probably benign Het
Scn1a T A 2: 66,332,213 I230F probably damaging Het
Taar7e T A 10: 24,037,615 M1K probably null Het
Tex15 T G 8: 33,573,184 L1155V probably benign Het
Tmprss3 T C 17: 31,188,357 K321E probably benign Het
Tsc2 A T 17: 24,613,229 C728S probably damaging Het
Ube2e3 A T 2: 78,920,039 K203M probably damaging Het
Unc50 A T 1: 37,438,702 T222S probably damaging Het
Vmn1r236 A T 17: 21,287,616 H332L probably benign Het
Vmn2r7 G A 3: 64,691,339 T599I probably benign Het
Zfp334 A T 2: 165,381,879 D81E possibly damaging Het
Zfp710 A G 7: 80,082,040 I322V possibly damaging Het
Other mutations in Pomt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Pomt1 APN 2 32241772 missense probably benign
IGL01926:Pomt1 APN 2 32243472 missense probably benign 0.23
IGL02237:Pomt1 APN 2 32245677 missense probably benign 0.18
IGL02281:Pomt1 APN 2 32248646 missense possibly damaging 0.95
IGL03001:Pomt1 APN 2 32244326 missense probably benign
IGL03216:Pomt1 APN 2 32242943 missense probably damaging 0.99
IGL03343:Pomt1 APN 2 32253712 splice site probably benign
R0049:Pomt1 UTSW 2 32252011 missense possibly damaging 0.88
R0049:Pomt1 UTSW 2 32252011 missense possibly damaging 0.88
R0975:Pomt1 UTSW 2 32253895 critical splice donor site probably null
R1199:Pomt1 UTSW 2 32250492 missense probably benign
R1414:Pomt1 UTSW 2 32243610 splice site probably benign
R1421:Pomt1 UTSW 2 32236753 unclassified probably benign
R1806:Pomt1 UTSW 2 32241668 missense probably damaging 1.00
R2173:Pomt1 UTSW 2 32250900 missense probably damaging 1.00
R2209:Pomt1 UTSW 2 32250862 missense possibly damaging 0.90
R2302:Pomt1 UTSW 2 32243659 missense probably benign 0.00
R3084:Pomt1 UTSW 2 32244240 missense probably benign 0.02
R3774:Pomt1 UTSW 2 32244250 missense possibly damaging 0.93
R3933:Pomt1 UTSW 2 32245619 missense probably benign 0.00
R4177:Pomt1 UTSW 2 32248677 missense probably damaging 0.99
R4626:Pomt1 UTSW 2 32254412 missense possibly damaging 0.84
R4645:Pomt1 UTSW 2 32242876 intron probably benign
R4864:Pomt1 UTSW 2 32251992 missense probably benign 0.02
R4911:Pomt1 UTSW 2 32241679 missense probably damaging 0.97
R5143:Pomt1 UTSW 2 32254329 missense probably benign 0.23
R5288:Pomt1 UTSW 2 32244299 nonsense probably null
R5385:Pomt1 UTSW 2 32244299 nonsense probably null
R5718:Pomt1 UTSW 2 32248692 missense possibly damaging 0.91
R5735:Pomt1 UTSW 2 32243505 missense probably damaging 1.00
R5754:Pomt1 UTSW 2 32247590 missense probably damaging 0.99
R5817:Pomt1 UTSW 2 32248679 missense probably damaging 0.97
R6304:Pomt1 UTSW 2 32250790 missense probably damaging 1.00
R6477:Pomt1 UTSW 2 32248716 splice site probably null
R6793:Pomt1 UTSW 2 32242949 missense probably damaging 1.00
R7114:Pomt1 UTSW 2 32253836 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- AGAGTCCAGTGCCCCAAATC -3'
(R):5'- TGTGTTCCTATCCAGGGAGG -3'

Sequencing Primer
(F):5'- CAAGAGAGAGGAAGTTAGTTCTTGTC -3'
(R):5'- TTCCTATCCAGGGAGGGTACACTAAC -3'
Posted On2018-11-06