Incidental Mutation 'R6931:Trib2'
ID 540049
Institutional Source Beutler Lab
Gene Symbol Trib2
Ensembl Gene ENSMUSG00000020601
Gene Name tribbles pseudokinase 2
Synonyms TRB2
MMRRC Submission 045326-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.530) question?
Stock # R6931 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 15841728-15866923 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 15843640 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 198 (M198K)
Ref Sequence ENSEMBL: ENSMUSP00000152535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020922] [ENSMUST00000221518]
AlphaFold Q8K4K3
Predicted Effect probably benign
Transcript: ENSMUST00000020922
AA Change: M334K

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000020922
Gene: ENSMUSG00000020601
AA Change: M334K

DomainStartEndE-ValueType
Pfam:Pkinase 72 308 1.2e-36 PFAM
Pfam:Pkinase_Tyr 98 305 4.6e-19 PFAM
Pfam:Kinase-like 111 296 5.7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221518
AA Change: M198K

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of three members of the Tribbles family. The Tribbles members share a Trb domain, which is homologous to protein serine-threonine kinases, but lacks the active site lysine and probably lacks a catalytic function. The Tribbles proteins interact and modulate the activity of signal transduction pathways in a number of physiological and pathological processes. This Tribbles member induces apoptosis of cells mainly of the hematopoietic origin. It has been identified as a protein up-regulated by inflammatory stimuli in myeloid (THP-1) cells, and also as an oncogene that inactivates the transcription factor C/EBPalpha (CCAAT/enhancer-binding protein alpha) and causes acute myelogenous leukemia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit nitrituria. Female homozygotes display decreased circulating triglyceride levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310003L06Rik T A 5: 88,118,561 (GRCm39) I15N probably damaging Het
2900092C05Rik T A 7: 12,246,523 (GRCm39) S6R unknown Het
Abca6 T A 11: 110,135,154 (GRCm39) L210F probably benign Het
Abcc4 T C 14: 118,765,400 (GRCm39) Q919R probably damaging Het
Adcy1 A G 11: 7,100,884 (GRCm39) D811G possibly damaging Het
Akna A G 4: 63,305,339 (GRCm39) S476P probably benign Het
Ankrd49 T C 9: 14,694,122 (GRCm39) N15S probably benign Het
Apcdd1 A G 18: 63,066,979 (GRCm39) D31G probably damaging Het
Aplp1 G T 7: 30,142,625 (GRCm39) R106S probably damaging Het
Arhgap40 T C 2: 158,373,138 (GRCm39) L132S probably benign Het
Atp8b5 G T 4: 43,364,108 (GRCm39) probably null Het
Axl T C 7: 25,460,858 (GRCm39) D717G probably damaging Het
Bub1 T A 2: 127,643,302 (GRCm39) D1014V probably damaging Het
Cacna2d4 T A 6: 119,259,195 (GRCm39) V603E possibly damaging Het
Cnot11 G C 1: 39,579,002 (GRCm39) C289S probably damaging Het
Coasy A G 11: 100,974,407 (GRCm39) H191R probably benign Het
Cyp11a1 A T 9: 57,932,403 (GRCm39) N341Y possibly damaging Het
Cyp1a2 T C 9: 57,589,439 (GRCm39) N125S probably benign Het
Cyp2j8 A T 4: 96,333,018 (GRCm39) probably null Het
Dnah9 A T 11: 66,008,452 (GRCm39) I791K possibly damaging Het
Ecm2 A T 13: 49,682,487 (GRCm39) Q505H probably benign Het
Fam135a T A 1: 24,124,568 (GRCm39) M1L probably damaging Het
Fam171a2 A G 11: 102,329,260 (GRCm39) S500P possibly damaging Het
Fat3 A G 9: 15,871,238 (GRCm39) S3718P possibly damaging Het
Frem1 G A 4: 82,888,914 (GRCm39) P1085S probably damaging Het
Gcfc2 A G 6: 81,919,966 (GRCm39) I390V probably benign Het
Gemin4 A G 11: 76,101,782 (GRCm39) L993P probably damaging Het
Ggnbp2 T A 11: 84,723,993 (GRCm39) D647V probably damaging Het
Gpr84 A C 15: 103,217,441 (GRCm39) L212R probably damaging Het
Hnrnpu T C 1: 178,158,997 (GRCm39) probably benign Het
Hspg2 G T 4: 137,268,031 (GRCm39) C2116F probably damaging Het
Icam4 T A 9: 20,941,747 (GRCm39) V249E probably damaging Het
Itga1 T C 13: 115,138,099 (GRCm39) N429D probably benign Het
Kcns1 T C 2: 164,006,758 (GRCm39) T402A probably damaging Het
Ky T A 9: 102,414,826 (GRCm39) V246E probably damaging Het
Marchf1 A G 8: 66,921,144 (GRCm39) T529A probably benign Het
Med18 C G 4: 132,187,194 (GRCm39) V102L probably damaging Het
Mlst8 T C 17: 24,696,249 (GRCm39) D160G probably damaging Het
Mthfd1 T C 12: 76,350,472 (GRCm39) I470T probably benign Het
Muc1 C T 3: 89,136,466 (GRCm39) probably benign Het
Mup8 G A 4: 60,220,322 (GRCm39) L137F probably damaging Het
Mybpc1 A T 10: 88,378,192 (GRCm39) L341* probably null Het
Nacad A G 11: 6,551,877 (GRCm39) F438S probably benign Het
Necap2 C A 4: 140,805,523 (GRCm39) probably null Het
Nifk T C 1: 118,260,078 (GRCm39) L163S possibly damaging Het
Npsr1 A G 9: 24,201,293 (GRCm39) I73V probably benign Het
Nup50l T C 6: 96,142,529 (GRCm39) T172A possibly damaging Het
Oog3 C T 4: 143,885,923 (GRCm39) C225Y probably benign Het
Or2d2 A G 7: 106,728,108 (GRCm39) L164P probably damaging Het
Or4b13 A T 2: 90,083,121 (GRCm39) C70* probably null Het
Or4c100 T A 2: 88,356,538 (GRCm39) C204S possibly damaging Het
Or4p18 G A 2: 88,232,408 (GRCm39) T290I probably benign Het
Plagl2 C A 2: 153,077,863 (GRCm39) K39N probably benign Het
Plcg2 T A 8: 118,284,058 (GRCm39) D118E probably benign Het
Ppp4r3b A T 11: 29,161,786 (GRCm39) K720I possibly damaging Het
Prmt3 A T 7: 49,478,764 (GRCm39) T442S probably benign Het
Prr14l G A 5: 32,988,035 (GRCm39) H487Y probably damaging Het
Psmb3 G A 11: 97,594,797 (GRCm39) V63I probably benign Het
Psmc6 T A 14: 45,581,182 (GRCm39) I326K possibly damaging Het
Ptcd1 T C 5: 145,091,885 (GRCm39) T405A probably benign Het
Rbm33 G A 5: 28,615,743 (GRCm39) V29M probably damaging Het
Rsrc1 C T 3: 66,901,982 (GRCm39) P44L unknown Het
Scarb1 T A 5: 125,361,783 (GRCm39) I107F probably damaging Het
Slc39a12 A G 2: 14,394,186 (GRCm39) S19G probably benign Het
Slc44a5 T C 3: 153,964,143 (GRCm39) V503A probably benign Het
Slc9a9 T C 9: 94,552,139 (GRCm39) S9P possibly damaging Het
Snrnp35 A C 5: 124,628,764 (GRCm39) R192S possibly damaging Het
Tbx15 T C 3: 99,259,467 (GRCm39) L446P probably damaging Het
Tlnrd1 A G 7: 83,531,805 (GRCm39) F209L probably benign Het
Tmprss12 C T 15: 100,183,149 (GRCm39) R164C probably damaging Het
Tnfsf4 T A 1: 161,244,644 (GRCm39) F111Y possibly damaging Het
Ttll8 A G 15: 88,798,507 (GRCm39) S743P possibly damaging Het
Ush2a A T 1: 188,460,580 (GRCm39) N2614Y probably benign Het
Usp6nl G A 2: 6,435,269 (GRCm39) V343I possibly damaging Het
Vrtn C A 12: 84,697,016 (GRCm39) Q589K probably benign Het
Zbed5 T A 5: 129,932,170 (GRCm39) Y706* probably null Het
Zc3h10 A G 10: 128,380,553 (GRCm39) V268A probably damaging Het
Zfp442 C T 2: 150,252,860 (GRCm39) probably null Het
Zpld2 A T 4: 133,920,464 (GRCm39) M567K probably benign Het
Other mutations in Trib2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00958:Trib2 APN 12 15,843,634 (GRCm39) missense possibly damaging 0.86
IGL02248:Trib2 APN 12 15,843,967 (GRCm39) missense possibly damaging 0.67
IGL03145:Trib2 APN 12 15,859,932 (GRCm39) missense probably damaging 0.99
R0008:Trib2 UTSW 12 15,859,930 (GRCm39) missense probably benign 0.15
R0008:Trib2 UTSW 12 15,859,930 (GRCm39) missense probably benign 0.15
R0118:Trib2 UTSW 12 15,843,929 (GRCm39) missense probably damaging 1.00
R0399:Trib2 UTSW 12 15,843,664 (GRCm39) missense probably damaging 1.00
R0600:Trib2 UTSW 12 15,844,069 (GRCm39) missense probably damaging 0.99
R1928:Trib2 UTSW 12 15,865,454 (GRCm39) missense probably damaging 0.99
R2153:Trib2 UTSW 12 15,843,830 (GRCm39) missense probably damaging 1.00
R5056:Trib2 UTSW 12 15,843,795 (GRCm39) missense possibly damaging 0.95
R6571:Trib2 UTSW 12 15,844,060 (GRCm39) missense probably damaging 1.00
R6874:Trib2 UTSW 12 15,865,338 (GRCm39) missense probably damaging 1.00
R6988:Trib2 UTSW 12 15,865,339 (GRCm39) missense probably damaging 0.99
R8519:Trib2 UTSW 12 15,865,347 (GRCm39) missense probably damaging 1.00
R9352:Trib2 UTSW 12 15,865,413 (GRCm39) missense probably benign 0.01
R9541:Trib2 UTSW 12 15,866,827 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TGTTCCGTCAGCTCCTAGAAC -3'
(R):5'- TCTCTTTTCAGTAAGATCCGCAG -3'

Sequencing Primer
(F):5'- GAACATATTCCTTCTCTGAACCAAG -3'
(R):5'- AGGGGCCAGTTCAACATTC -3'
Posted On 2018-11-06