Incidental Mutation 'R6931:Nacad'
ID 540039
Institutional Source Beutler Lab
Gene Symbol Nacad
Ensembl Gene ENSMUSG00000041073
Gene Name NAC alpha domain containing
Synonyms mKIAA0363
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6931 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 6597823-6606053 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 6601877 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 438 (F438S)
Ref Sequence ENSEMBL: ENSMUSP00000049490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045713]
AlphaFold Q5SWP3
Predicted Effect probably benign
Transcript: ENSMUST00000045713
AA Change: F438S

PolyPhen 2 Score 0.136 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000049490
Gene: ENSMUSG00000041073
AA Change: F438S

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
low complexity region 70 87 N/A INTRINSIC
low complexity region 228 235 N/A INTRINSIC
low complexity region 266 277 N/A INTRINSIC
low complexity region 294 306 N/A INTRINSIC
low complexity region 328 354 N/A INTRINSIC
low complexity region 391 422 N/A INTRINSIC
low complexity region 454 479 N/A INTRINSIC
internal_repeat_1 537 689 6.19e-8 PROSPERO
low complexity region 692 713 N/A INTRINSIC
internal_repeat_1 732 889 6.19e-8 PROSPERO
low complexity region 924 939 N/A INTRINSIC
low complexity region 1159 1170 N/A INTRINSIC
low complexity region 1308 1325 N/A INTRINSIC
Pfam:NAC 1357 1413 2.9e-24 PFAM
low complexity region 1449 1466 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177050
Predicted Effect probably benign
Transcript: ENSMUST00000177391
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 99% (77/78)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,165,548 T172A possibly damaging Het
2310003L06Rik T A 5: 87,970,702 I15N probably damaging Het
2900092C05Rik T A 7: 12,512,596 S6R unknown Het
Abca6 T A 11: 110,244,328 L210F probably benign Het
Abcc4 T C 14: 118,527,988 Q919R probably damaging Het
Adcy1 A G 11: 7,150,884 D811G possibly damaging Het
Akna A G 4: 63,387,102 S476P probably benign Het
Ankrd49 T C 9: 14,782,826 N15S probably benign Het
Apcdd1 A G 18: 62,933,908 D31G probably damaging Het
Aplp1 G T 7: 30,443,200 R106S probably damaging Het
Arhgap40 T C 2: 158,531,218 L132S probably benign Het
Atp8b5 G T 4: 43,364,108 probably null Het
Axl T C 7: 25,761,433 D717G probably damaging Het
Bub1 T A 2: 127,801,382 D1014V probably damaging Het
Cacna2d4 T A 6: 119,282,234 V603E possibly damaging Het
Cnot11 G C 1: 39,539,921 C289S probably damaging Het
Coasy A G 11: 101,083,581 H191R probably benign Het
Cyp11a1 A T 9: 58,025,120 N341Y possibly damaging Het
Cyp1a2 T C 9: 57,682,156 N125S probably benign Het
Cyp2j8 A T 4: 96,444,781 probably null Het
Dnah9 A T 11: 66,117,626 I791K possibly damaging Het
Ecm2 A T 13: 49,529,011 Q505H probably benign Het
Fam135a T A 1: 24,085,487 M1L probably damaging Het
Fam171a2 A G 11: 102,438,434 S500P possibly damaging Het
Fat3 A G 9: 15,959,942 S3718P possibly damaging Het
Frem1 G A 4: 82,970,677 P1085S probably damaging Het
Gcfc2 A G 6: 81,942,985 I390V probably benign Het
Gemin4 A G 11: 76,210,956 L993P probably damaging Het
Ggnbp2 T A 11: 84,833,167 D647V probably damaging Het
Gm7534 A T 4: 134,193,153 M567K probably benign Het
Gpr84 A C 15: 103,309,014 L212R probably damaging Het
Hnrnpu T C 1: 178,331,432 probably benign Het
Hspg2 G T 4: 137,540,720 C2116F probably damaging Het
Icam4 T A 9: 21,030,451 V249E probably damaging Het
Itga1 T C 13: 115,001,563 N429D probably benign Het
Kcns1 T C 2: 164,164,838 T402A probably damaging Het
Ky T A 9: 102,537,627 V246E probably damaging Het
March1 A G 8: 66,468,492 T529A probably benign Het
Med18 C G 4: 132,459,883 V102L probably damaging Het
Mlst8 T C 17: 24,477,275 D160G probably damaging Het
Mthfd1 T C 12: 76,303,698 I470T probably benign Het
Muc1 C T 3: 89,229,159 probably benign Het
Mup8 G A 4: 60,220,322 L137F probably damaging Het
Mybpc1 A T 10: 88,542,330 L341* probably null Het
Necap2 C A 4: 141,078,212 probably null Het
Nifk T C 1: 118,332,348 L163S possibly damaging Het
Npsr1 A G 9: 24,289,997 I73V probably benign Het
Olfr1179 G A 2: 88,402,064 T290I probably benign Het
Olfr1186 T A 2: 88,526,194 C204S possibly damaging Het
Olfr142 A T 2: 90,252,777 C70* probably null Het
Olfr715 A G 7: 107,128,901 L164P probably damaging Het
Oog3 C T 4: 144,159,353 C225Y probably benign Het
Plagl2 C A 2: 153,235,943 K39N probably benign Het
Plcg2 T A 8: 117,557,319 D118E probably benign Het
Ppp4r3b A T 11: 29,211,786 K720I possibly damaging Het
Prmt3 A T 7: 49,829,016 T442S probably benign Het
Prr14l G A 5: 32,830,691 H487Y probably damaging Het
Psmb3 G A 11: 97,703,971 V63I probably benign Het
Psmc6 T A 14: 45,343,725 I326K possibly damaging Het
Ptcd1 T C 5: 145,155,075 T405A probably benign Het
Rbm33 G A 5: 28,410,745 V29M probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Scarb1 T A 5: 125,284,719 I107F probably damaging Het
Slc39a12 A G 2: 14,389,375 S19G probably benign Het
Slc44a5 T C 3: 154,258,506 V503A probably benign Het
Slc9a9 T C 9: 94,670,086 S9P possibly damaging Het
Snrnp35 A C 5: 124,490,701 R192S possibly damaging Het
Tbx15 T C 3: 99,352,151 L446P probably damaging Het
Tlnrd1 A G 7: 83,882,597 F209L probably benign Het
Tmprss12 C T 15: 100,285,268 R164C probably damaging Het
Tnfsf4 T A 1: 161,417,073 F111Y possibly damaging Het
Trib2 A T 12: 15,793,639 M198K probably benign Het
Ttll8 A G 15: 88,914,304 S743P possibly damaging Het
Ush2a A T 1: 188,728,383 N2614Y probably benign Het
Usp6nl G A 2: 6,430,458 V343I possibly damaging Het
Vrtn C A 12: 84,650,242 Q589K probably benign Het
Zbed5 T A 5: 129,903,329 Y706* probably null Het
Zc3h10 A G 10: 128,544,684 V268A probably damaging Het
Zfp442 C T 2: 150,410,940 probably null Het
Other mutations in Nacad
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Nacad APN 11 6600921 missense probably benign 0.24
IGL00903:Nacad APN 11 6600632 missense probably damaging 0.99
IGL01303:Nacad APN 11 6598279 missense possibly damaging 0.81
IGL01353:Nacad APN 11 6600530 missense possibly damaging 0.70
IGL01833:Nacad APN 11 6605700 missense unknown
IGL02267:Nacad APN 11 6602649 missense probably benign 0.14
IGL02531:Nacad APN 11 6598580 missense possibly damaging 0.90
IGL02994:Nacad APN 11 6599528 missense possibly damaging 0.83
IGL03121:Nacad APN 11 6600933 missense probably damaging 0.98
IGL03161:Nacad APN 11 6600378 nonsense probably null
Locusta UTSW 11 6602387 missense possibly damaging 0.88
migratoria UTSW 11 6601196 missense probably benign 0.30
FR4340:Nacad UTSW 11 6599761 small insertion probably benign
FR4342:Nacad UTSW 11 6599762 small insertion probably benign
FR4548:Nacad UTSW 11 6599752 small insertion probably benign
FR4548:Nacad UTSW 11 6599760 small insertion probably benign
FR4589:Nacad UTSW 11 6599753 small insertion probably benign
FR4976:Nacad UTSW 11 6599749 small insertion probably benign
FR4976:Nacad UTSW 11 6599756 small insertion probably benign
FR4976:Nacad UTSW 11 6599763 small insertion probably benign
PIT4402001:Nacad UTSW 11 6598621 missense probably benign 0.19
R0330:Nacad UTSW 11 6600903 missense probably benign
R0331:Nacad UTSW 11 6599441 missense possibly damaging 0.84
R0409:Nacad UTSW 11 6599810 missense probably benign 0.00
R0612:Nacad UTSW 11 6601382 missense possibly damaging 0.90
R0644:Nacad UTSW 11 6599486 missense possibly damaging 0.69
R0829:Nacad UTSW 11 6601158 missense probably benign 0.18
R1483:Nacad UTSW 11 6602217 missense probably damaging 0.99
R1583:Nacad UTSW 11 6601185 missense probably benign 0.08
R1905:Nacad UTSW 11 6602540 missense probably benign 0.15
R1907:Nacad UTSW 11 6602540 missense probably benign 0.15
R2361:Nacad UTSW 11 6600821 missense probably benign
R2979:Nacad UTSW 11 6601424 missense probably benign 0.06
R4192:Nacad UTSW 11 6605534 missense probably benign 0.44
R4381:Nacad UTSW 11 6600204 missense probably benign 0.18
R4539:Nacad UTSW 11 6600677 missense possibly damaging 0.94
R4751:Nacad UTSW 11 6605726 missense unknown
R4944:Nacad UTSW 11 6598507 missense possibly damaging 0.95
R4962:Nacad UTSW 11 6599169 missense probably damaging 1.00
R5102:Nacad UTSW 11 6598528 missense probably damaging 1.00
R5189:Nacad UTSW 11 6601611 missense probably damaging 0.98
R5296:Nacad UTSW 11 6605745 missense unknown
R5566:Nacad UTSW 11 6602136 missense probably damaging 1.00
R5634:Nacad UTSW 11 6602387 missense possibly damaging 0.88
R5725:Nacad UTSW 11 6601643 missense probably benign 0.15
R5748:Nacad UTSW 11 6598370 nonsense probably null
R5864:Nacad UTSW 11 6600581 missense probably benign
R5882:Nacad UTSW 11 6598568 missense possibly damaging 0.95
R6089:Nacad UTSW 11 6601331 missense probably benign 0.03
R6117:Nacad UTSW 11 6599810 missense probably benign 0.00
R6161:Nacad UTSW 11 6600902 missense probably benign
R6351:Nacad UTSW 11 6599235 missense probably damaging 1.00
R6351:Nacad UTSW 11 6600165 nonsense probably null
R6366:Nacad UTSW 11 6601196 missense probably benign 0.30
R6525:Nacad UTSW 11 6602255 missense probably damaging 1.00
R6811:Nacad UTSW 11 6599400 missense possibly damaging 0.66
R6966:Nacad UTSW 11 6602634 missense possibly damaging 0.93
R7228:Nacad UTSW 11 6598412 missense probably benign 0.19
R7248:Nacad UTSW 11 6598589 nonsense probably null
R7556:Nacad UTSW 11 6601272 missense possibly damaging 0.90
R7594:Nacad UTSW 11 6602457 missense probably damaging 0.99
R7813:Nacad UTSW 11 6599071 missense probably benign 0.38
R7841:Nacad UTSW 11 6601031 missense probably benign 0.00
R8243:Nacad UTSW 11 6602643 missense probably damaging 0.96
R8810:Nacad UTSW 11 6602853 missense probably benign 0.15
R9042:Nacad UTSW 11 6598948 missense possibly damaging 0.95
R9057:Nacad UTSW 11 6600876 missense possibly damaging 0.53
R9114:Nacad UTSW 11 6602252 missense probably damaging 1.00
R9328:Nacad UTSW 11 6602417 missense possibly damaging 0.84
R9394:Nacad UTSW 11 6599390 missense probably damaging 1.00
R9595:Nacad UTSW 11 6601790 missense not run
T0975:Nacad UTSW 11 6599750 small insertion probably benign
T0975:Nacad UTSW 11 6601622 missense probably benign 0.03
T0975:Nacad UTSW 11 6601632 missense probably benign 0.17
X0011:Nacad UTSW 11 6601074 missense probably benign 0.00
Z1176:Nacad UTSW 11 6602297 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGTATTCTGAGCACTGGGC -3'
(R):5'- TTTGACCCAAACTTCCTGGC -3'

Sequencing Primer
(F):5'- CACTGGGCTGGGCATGG -3'
(R):5'- TGGCCAACGACCCGATGATC -3'
Posted On 2018-11-06