Incidental Mutation 'R6931:Ecm2'
ID540052
Institutional Source Beutler Lab
Gene Symbol Ecm2
Ensembl Gene ENSMUSG00000043631
Gene Nameextracellular matrix protein 2, female organ and adipocyte specific
Synonymstenonectin, 9030618O22Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_001012324.2; MGI:3039578

Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R6931 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location49504810-49532789 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 49529011 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 505 (Q505H)
Ref Sequence ENSEMBL: ENSMUSP00000060402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021818] [ENSMUST00000051504]
Predicted Effect probably benign
Transcript: ENSMUST00000021818
SMART Domains Protein: ENSMUSP00000021818
Gene: ENSMUSG00000021391

DomainStartEndE-ValueType
coiled coil region 1 34 N/A INTRINSIC
Pfam:CENP-P 102 278 3.9e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000051504
AA Change: Q505H

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000060402
Gene: ENSMUSG00000043631
AA Change: Q505H

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 21 36 N/A INTRINSIC
VWC 98 152 1.37e-11 SMART
coiled coil region 235 269 N/A INTRINSIC
low complexity region 278 289 N/A INTRINSIC
LRR 314 336 1.41e2 SMART
LRR 337 362 1.76e-1 SMART
LRR 363 386 5.41e0 SMART
LRR 408 433 1.91e1 SMART
LRR 434 457 4.98e-1 SMART
LRR 459 478 8.03e1 SMART
LRR 506 528 2.76e1 SMART
LRR 529 549 1.19e2 SMART
LRR 578 600 1.81e1 SMART
LRR 601 624 9.48e0 SMART
LRR 631 655 6.06e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ECM2 encodes extracellular matrix protein 2, so named because it shares extensive similarity with known extracelluar matrix proteins. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2010]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,165,548 T172A possibly damaging Het
2310003L06Rik T A 5: 87,970,702 I15N probably damaging Het
2900092C05Rik T A 7: 12,512,596 S6R unknown Het
Abca6 T A 11: 110,244,328 L210F probably benign Het
Abcc4 T C 14: 118,527,988 Q919R probably damaging Het
Adcy1 A G 11: 7,150,884 D811G possibly damaging Het
Akna A G 4: 63,387,102 S476P probably benign Het
Ankrd49 T C 9: 14,782,826 N15S probably benign Het
Apcdd1 A G 18: 62,933,908 D31G probably damaging Het
Aplp1 G T 7: 30,443,200 R106S probably damaging Het
Arhgap40 T C 2: 158,531,218 L132S probably benign Het
Atp8b5 G T 4: 43,364,108 probably null Het
Axl T C 7: 25,761,433 D717G probably damaging Het
Bub1 T A 2: 127,801,382 D1014V probably damaging Het
Cacna2d4 T A 6: 119,282,234 V603E possibly damaging Het
Cnot11 G C 1: 39,539,921 C289S probably damaging Het
Coasy A G 11: 101,083,581 H191R probably benign Het
Cyp11a1 A T 9: 58,025,120 N341Y possibly damaging Het
Cyp1a2 T C 9: 57,682,156 N125S probably benign Het
Cyp2j8 A T 4: 96,444,781 probably null Het
Dnah9 A T 11: 66,117,626 I791K possibly damaging Het
Fam135a T A 1: 24,085,487 M1L probably damaging Het
Fam171a2 A G 11: 102,438,434 S500P possibly damaging Het
Fat3 A G 9: 15,959,942 S3718P possibly damaging Het
Frem1 G A 4: 82,970,677 P1085S probably damaging Het
Gcfc2 A G 6: 81,942,985 I390V probably benign Het
Gemin4 A G 11: 76,210,956 L993P probably damaging Het
Ggnbp2 T A 11: 84,833,167 D647V probably damaging Het
Gm7534 A T 4: 134,193,153 M567K probably benign Het
Gpr84 A C 15: 103,309,014 L212R probably damaging Het
Hnrnpu T C 1: 178,331,432 probably benign Het
Hspg2 G T 4: 137,540,720 C2116F probably damaging Het
Icam4 T A 9: 21,030,451 V249E probably damaging Het
Itga1 T C 13: 115,001,563 N429D probably benign Het
Kcns1 T C 2: 164,164,838 T402A probably damaging Het
Ky T A 9: 102,537,627 V246E probably damaging Het
March1 A G 8: 66,468,492 T529A probably benign Het
Med18 C G 4: 132,459,883 V102L probably damaging Het
Mlst8 T C 17: 24,477,275 D160G probably damaging Het
Mthfd1 T C 12: 76,303,698 I470T probably benign Het
Muc1 C T 3: 89,229,159 probably benign Het
Mup8 G A 4: 60,220,322 L137F probably damaging Het
Mybpc1 A T 10: 88,542,330 L341* probably null Het
Nacad A G 11: 6,601,877 F438S probably benign Het
Necap2 C A 4: 141,078,212 probably null Het
Nifk T C 1: 118,332,348 L163S possibly damaging Het
Npsr1 A G 9: 24,289,997 I73V probably benign Het
Olfr1179 G A 2: 88,402,064 T290I probably benign Het
Olfr1186 T A 2: 88,526,194 C204S possibly damaging Het
Olfr142 A T 2: 90,252,777 C70* probably null Het
Olfr715 A G 7: 107,128,901 L164P probably damaging Het
Oog3 C T 4: 144,159,353 C225Y probably benign Het
Plagl2 C A 2: 153,235,943 K39N probably benign Het
Plcg2 T A 8: 117,557,319 D118E probably benign Het
Ppp4r3b A T 11: 29,211,786 K720I possibly damaging Het
Prmt3 A T 7: 49,829,016 T442S probably benign Het
Prr14l G A 5: 32,830,691 H487Y probably damaging Het
Psmb3 G A 11: 97,703,971 V63I probably benign Het
Psmc6 T A 14: 45,343,725 I326K possibly damaging Het
Ptcd1 T C 5: 145,155,075 T405A probably benign Het
Rbm33 G A 5: 28,410,745 V29M probably damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Scarb1 T A 5: 125,284,719 I107F probably damaging Het
Slc39a12 A G 2: 14,389,375 S19G probably benign Het
Slc44a5 T C 3: 154,258,506 V503A probably benign Het
Slc9a9 T C 9: 94,670,086 S9P possibly damaging Het
Snrnp35 A C 5: 124,490,701 R192S possibly damaging Het
Tbx15 T C 3: 99,352,151 L446P probably damaging Het
Tlnrd1 A G 7: 83,882,597 F209L probably benign Het
Tmprss12 C T 15: 100,285,268 R164C probably damaging Het
Tnfsf4 T A 1: 161,417,073 F111Y possibly damaging Het
Trib2 A T 12: 15,793,639 M198K probably benign Het
Ttll8 A G 15: 88,914,304 S743P possibly damaging Het
Ush2a A T 1: 188,728,383 N2614Y probably benign Het
Usp6nl G A 2: 6,430,458 V343I possibly damaging Het
Vrtn C A 12: 84,650,242 Q589K probably benign Het
Zbed5 T A 5: 129,903,329 Y706* probably null Het
Zc3h10 A G 10: 128,544,684 V268A probably damaging Het
Zfp442 C T 2: 150,410,940 probably null Het
Other mutations in Ecm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00677:Ecm2 APN 13 49531318 missense probably benign 0.14
IGL01685:Ecm2 APN 13 49528898 missense probably damaging 1.00
IGL02070:Ecm2 APN 13 49518370 missense probably damaging 1.00
IGL02108:Ecm2 APN 13 49518444 nonsense probably null
IGL02138:Ecm2 APN 13 49522828 missense probably damaging 1.00
IGL02937:Ecm2 APN 13 49518476 missense probably damaging 0.99
IGL03350:Ecm2 APN 13 49520944 missense probably benign
R0049:Ecm2 UTSW 13 49524446 nonsense probably null
R0049:Ecm2 UTSW 13 49524446 nonsense probably null
R0627:Ecm2 UTSW 13 49521083 splice site probably benign
R1515:Ecm2 UTSW 13 49518332 missense possibly damaging 0.87
R1864:Ecm2 UTSW 13 49530145 missense probably benign 0.28
R1865:Ecm2 UTSW 13 49530145 missense probably benign 0.28
R1991:Ecm2 UTSW 13 49530256 missense probably benign 0.28
R2103:Ecm2 UTSW 13 49530256 missense probably benign 0.28
R2181:Ecm2 UTSW 13 49530289 missense probably damaging 1.00
R2209:Ecm2 UTSW 13 49530156 missense probably damaging 1.00
R2568:Ecm2 UTSW 13 49530129 missense possibly damaging 0.81
R4856:Ecm2 UTSW 13 49522787 missense possibly damaging 0.47
R4867:Ecm2 UTSW 13 49531345 missense probably damaging 0.99
R4886:Ecm2 UTSW 13 49522787 missense possibly damaging 0.47
R5368:Ecm2 UTSW 13 49520943 missense probably benign
R5420:Ecm2 UTSW 13 49527734 missense possibly damaging 0.65
R6084:Ecm2 UTSW 13 49515094 nonsense probably null
R6244:Ecm2 UTSW 13 49530307 missense probably damaging 1.00
R6881:Ecm2 UTSW 13 49530342 nonsense probably null
R7085:Ecm2 UTSW 13 49520902 missense probably damaging 1.00
R7347:Ecm2 UTSW 13 49515078 missense probably damaging 0.99
R7490:Ecm2 UTSW 13 49530342 nonsense probably null
R8039:Ecm2 UTSW 13 49514850 missense probably benign
R8131:Ecm2 UTSW 13 49518464 missense probably benign 0.33
R8333:Ecm2 UTSW 13 49518383 missense probably damaging 1.00
R8345:Ecm2 UTSW 13 49520800 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCCCATAATCATGATAGGCAGTAC -3'
(R):5'- AGCATTTGATTGTTAGGGATCAGC -3'

Sequencing Primer
(F):5'- TGGATGCCATTGAATACAAACAG -3'
(R):5'- GGATCAGCCCTCATTTCTTGC -3'
Posted On2018-11-06