Incidental Mutation 'R6963:Vps50'
ID543327
Institutional Source Beutler Lab
Gene Symbol Vps50
Ensembl Gene ENSMUSG00000001376
Gene NameVPS50 EARP/GARPII complex subunit
Synonyms8430415E05Rik, 1700034M03Rik, Ccdc132
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.903) question?
Stock #R6963 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location3498382-3603531 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 3592577 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001412] [ENSMUST00000001412] [ENSMUST00000164052] [ENSMUST00000164052] [ENSMUST00000170873] [ENSMUST00000170873]
Predicted Effect probably null
Transcript: ENSMUST00000001412
SMART Domains Protein: ENSMUSP00000001412
Gene: ENSMUSG00000001376

DomainStartEndE-ValueType
Pfam:DUF2450 54 345 2.5e-112 PFAM
low complexity region 659 676 N/A INTRINSIC
Pfam:DUF2451 723 957 2.2e-98 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000001412
SMART Domains Protein: ENSMUSP00000001412
Gene: ENSMUSG00000001376

DomainStartEndE-ValueType
Pfam:DUF2450 54 345 2.5e-112 PFAM
low complexity region 659 676 N/A INTRINSIC
Pfam:DUF2451 723 957 2.2e-98 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000164052
SMART Domains Protein: ENSMUSP00000125872
Gene: ENSMUSG00000001376

DomainStartEndE-ValueType
Pfam:DUF2450 54 345 5.2e-111 PFAM
low complexity region 659 676 N/A INTRINSIC
Pfam:DUF2451 723 929 1.1e-90 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000164052
SMART Domains Protein: ENSMUSP00000125872
Gene: ENSMUSG00000001376

DomainStartEndE-ValueType
Pfam:DUF2450 54 345 5.2e-111 PFAM
low complexity region 659 676 N/A INTRINSIC
Pfam:DUF2451 723 929 1.1e-90 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000170873
SMART Domains Protein: ENSMUSP00000128323
Gene: ENSMUSG00000001376

DomainStartEndE-ValueType
Pfam:DUF2450 54 345 5.3e-111 PFAM
low complexity region 659 676 N/A INTRINSIC
Pfam:DUF2451 723 933 2.6e-90 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000170873
SMART Domains Protein: ENSMUSP00000128323
Gene: ENSMUSG00000001376

DomainStartEndE-ValueType
Pfam:DUF2450 54 345 5.3e-111 PFAM
low complexity region 659 676 N/A INTRINSIC
Pfam:DUF2451 723 933 2.6e-90 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.5%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,896,456 H196Y probably damaging Het
Abi3 G A 11: 95,832,741 probably benign Het
Adgrb2 CG C 4: 130,014,362 probably null Het
Asgr1 T C 11: 70,055,968 probably null Het
Atp2c2 C T 8: 119,730,267 R203* probably null Het
Brms1 T A 19: 5,046,653 I121N probably damaging Het
Ccdc144b A G 3: 36,050,662 Y17H probably benign Het
Ccdc149 G A 5: 52,439,097 R58W probably damaging Het
D630003M21Rik T C 2: 158,200,308 E906G probably benign Het
Enpp5 G A 17: 44,085,264 G356S probably damaging Het
Fry A G 5: 150,457,844 T444A probably benign Het
Ggn A G 7: 29,171,582 E142G probably damaging Het
Gm21994 A G 2: 150,255,345 C55R probably damaging Het
Gm5150 A G 3: 16,006,391 probably benign Het
Gp2 A G 7: 119,452,897 V198A probably benign Het
Gstm3 A G 3: 107,967,624 V104A probably benign Het
Idua A G 5: 108,679,775 K152E possibly damaging Het
Igsf21 A G 4: 140,027,730 S443P probably benign Het
Kdm5d C A Y: 937,975 Q925K probably benign Het
Ly6k G C 15: 74,798,582 P37R probably damaging Het
Mcm9 A G 10: 53,548,617 S626P probably damaging Het
Mcoln2 A G 3: 146,172,035 K137R probably damaging Het
Mctp2 T C 7: 72,228,056 N298S probably damaging Het
Mpp6 T C 6: 50,163,655 probably null Het
Myo10 T C 15: 25,734,063 I379T probably benign Het
Myo15b G T 11: 115,890,714 probably null Het
Nrg1 A G 8: 31,917,662 F181S probably benign Het
Olfr1449 C T 19: 12,935,638 A300V probably damaging Het
Pde9a G T 17: 31,443,887 V97L probably benign Het
Rfc5 T A 5: 117,387,866 probably null Het
Rnf145 T C 11: 44,564,277 S662P probably benign Het
Rsf1 G A 7: 97,579,910 probably benign Het
Scfd2 A G 5: 74,482,209 V359A probably damaging Het
Skp2 T C 15: 9,139,428 probably null Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tekt2 T C 4: 126,324,317 E134G probably damaging Het
Ttll4 T A 1: 74,681,816 I547K probably damaging Het
Vmn1r4 T C 6: 56,956,784 I91T probably damaging Het
Vmn2r93 T C 17: 18,316,587 S511P probably damaging Het
Zeb2 T G 2: 44,988,799 E1141A probably damaging Het
Zfp326 T A 5: 105,911,493 Y373* probably null Het
Other mutations in Vps50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Vps50 APN 6 3602670 missense probably benign 0.00
IGL00764:Vps50 APN 6 3532177 nonsense probably null
IGL00844:Vps50 APN 6 3532177 nonsense probably null
IGL00845:Vps50 APN 6 3532177 nonsense probably null
IGL00850:Vps50 APN 6 3532177 nonsense probably null
IGL01417:Vps50 APN 6 3522377 splice site probably benign
IGL01648:Vps50 APN 6 3498545 missense probably benign 0.25
IGL03238:Vps50 APN 6 3594771 missense possibly damaging 0.60
IGL03285:Vps50 APN 6 3555011 missense possibly damaging 0.71
R0309:Vps50 UTSW 6 3536853 missense possibly damaging 0.90
R0513:Vps50 UTSW 6 3520210 missense probably damaging 1.00
R0714:Vps50 UTSW 6 3571105 missense probably benign 0.05
R1066:Vps50 UTSW 6 3533565 missense probably damaging 1.00
R1210:Vps50 UTSW 6 3594884 missense probably damaging 0.99
R1420:Vps50 UTSW 6 3588007 nonsense probably null
R1437:Vps50 UTSW 6 3517852 nonsense probably null
R1451:Vps50 UTSW 6 3565628 missense possibly damaging 0.77
R1470:Vps50 UTSW 6 3517777 splice site probably benign
R1576:Vps50 UTSW 6 3545568 missense possibly damaging 0.60
R1599:Vps50 UTSW 6 3565537 missense probably benign 0.00
R1860:Vps50 UTSW 6 3520279 critical splice donor site probably null
R2055:Vps50 UTSW 6 3522265 missense probably benign 0.01
R2109:Vps50 UTSW 6 3555379 missense probably damaging 0.99
R3408:Vps50 UTSW 6 3600212 missense probably damaging 1.00
R3732:Vps50 UTSW 6 3519243 synonymous silent
R3764:Vps50 UTSW 6 3588063 missense probably damaging 1.00
R3828:Vps50 UTSW 6 3533500 missense probably benign
R4092:Vps50 UTSW 6 3551037 missense probably benign
R4385:Vps50 UTSW 6 3516694 missense probably benign 0.00
R4588:Vps50 UTSW 6 3562306 missense probably damaging 1.00
R4843:Vps50 UTSW 6 3536974 critical splice donor site probably null
R4978:Vps50 UTSW 6 3517808 missense probably benign
R5368:Vps50 UTSW 6 3567739 missense possibly damaging 0.88
R5867:Vps50 UTSW 6 3536965 missense probably damaging 1.00
R6591:Vps50 UTSW 6 3504939 critical splice donor site probably null
R6626:Vps50 UTSW 6 3551101 nonsense probably null
R6691:Vps50 UTSW 6 3504939 critical splice donor site probably null
R6707:Vps50 UTSW 6 3545583 missense probably damaging 1.00
R6751:Vps50 UTSW 6 3600274 missense probably damaging 1.00
R6773:Vps50 UTSW 6 3592560 missense probably benign 0.25
R6867:Vps50 UTSW 6 3517835 missense probably benign 0.16
R6883:Vps50 UTSW 6 3498513 unclassified probably benign
R7147:Vps50 UTSW 6 3567750 nonsense probably null
R7150:Vps50 UTSW 6 3578854 missense possibly damaging 0.89
R7167:Vps50 UTSW 6 3600256 missense probably damaging 1.00
R7235:Vps50 UTSW 6 3588078 missense probably benign 0.01
R7385:Vps50 UTSW 6 3602708 missense probably benign 0.00
R7662:Vps50 UTSW 6 3562304 missense probably damaging 1.00
R7782:Vps50 UTSW 6 3532202 critical splice donor site probably null
X0025:Vps50 UTSW 6 3571012 missense probably benign 0.02
X0062:Vps50 UTSW 6 3594833 missense probably benign
Z1176:Vps50 UTSW 6 3578792 critical splice acceptor site probably null
Z1177:Vps50 UTSW 6 3555367 critical splice acceptor site probably null
Z1177:Vps50 UTSW 6 3562312 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTATTACGTAGCCGCGGTC -3'
(R):5'- ATGGATTCTACCAGGAAGCAG -3'

Sequencing Primer
(F):5'- TAGCCGCGGTCAGTCTGAC -3'
(R):5'- TGGCAATCTCTAGGCCAATG -3'
Posted On2018-11-28