Mutagenetix > Incidental Mutation

Incidental Mutation 'R6963:Ttll4'

543310

Institutional Source

Beutler Lab

Gene Symbol

Ttll4

Ensembl Gene

ENSMUSG00000033257

Gene Name

tubulin tyrosine ligase-like family, member 4

Synonyms

4632407P03Rik

MMRRC Submission

045073-MU

Accession Numbers

Genbank: NM_001014974.1; Ensembl: ENSMUST00000042125

Essential gene?

Probably non essential (E-score: 0.210) question?

Stock #

R6963 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

74661745-74703730 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 74681816 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 547 (I547K)

Ref Sequence

ENSEMBL: ENSMUSP00000037406 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042125] [ENSMUST00000113678] [ENSMUST00000129890] [ENSMUST00000141119]

AlphaFold

Q80UG8

Predicted Effect

probably damaging
Transcript: ENSMUST00000042125
AA Change: I547K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000037406
Gene: ENSMUSG00000033257
AA Change: I547K

Domain	Start	End	E-Value	Type
low complexity region	504	544	N/A	INTRINSIC
Pfam:TTL	645	940	2.2e-106	PFAM
low complexity region	942	961	N/A	INTRINSIC
low complexity region	1103	1113	N/A	INTRINSIC
low complexity region	1168	1182	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000113678
AA Change: I547K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000109308
Gene: ENSMUSG00000033257
AA Change: I547K

Domain	Start	End	E-Value	Type
low complexity region	504	544	N/A	INTRINSIC
Pfam:TTL	636	876	3.4e-82	PFAM
low complexity region	878	897	N/A	INTRINSIC
low complexity region	1039	1049	N/A	INTRINSIC
low complexity region	1104	1118	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000129890

SMART Domains

Protein: ENSMUSP00000119964
Gene: ENSMUSG00000033257

Domain	Start	End	E-Value	Type
low complexity region	69	101	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000141119
AA Change: I99K

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000116733
Gene: ENSMUSG00000033257
AA Change: I99K

Domain	Start	End	E-Value	Type
low complexity region	56	96	N/A	INTRINSIC

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.5%

Validation Efficiency

100% (41/41)

Allele List at MGI

All alleles(20) : Targeted, other(2) Gene trapped(18)

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	G	A	5: 76,896,456	H196Y	probably damaging	Het
Abi3	G	A	11: 95,832,741		probably benign	Het
Adgrb2	CG	C	4: 130,014,362		probably null	Het
Asgr1	T	C	11: 70,055,968		probably null	Het
Atp2c2	C	T	8: 119,730,267	R203*	probably null	Het
Brms1	T	A	19: 5,046,653	I121N	probably damaging	Het
Ccdc144b	A	G	3: 36,050,662	Y17H	probably benign	Het
Ccdc149	G	A	5: 52,439,097	R58W	probably damaging	Het
D630003M21Rik	T	C	2: 158,200,308	E906G	probably benign	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Fry	A	G	5: 150,457,844	T444A	probably benign	Het
Ggn	A	G	7: 29,171,582	E142G	probably damaging	Het
Gm21994	A	G	2: 150,255,345	C55R	probably damaging	Het
Gm5150	A	G	3: 16,006,391		probably benign	Het
Gp2	A	G	7: 119,452,897	V198A	probably benign	Het
Gstm3	A	G	3: 107,967,624	V104A	probably benign	Het
Idua	A	G	5: 108,679,775	K152E	possibly damaging	Het
Igsf21	A	G	4: 140,027,730	S443P	probably benign	Het
Kdm5d	C	A	Y: 937,975	Q925K	probably benign	Het
Ly6k	G	C	15: 74,798,582	P37R	probably damaging	Het
Mcm9	A	G	10: 53,548,617	S626P	probably damaging	Het
Mcoln2	A	G	3: 146,172,035	K137R	probably damaging	Het
Mctp2	T	C	7: 72,228,056	N298S	probably damaging	Het
Mpp6	T	C	6: 50,163,655		probably null	Het
Myo10	T	C	15: 25,734,063	I379T	probably benign	Het
Myo15b	G	T	11: 115,890,714		probably null	Het
Nrg1	A	G	8: 31,917,662	F181S	probably benign	Het
Olfr1449	C	T	19: 12,935,638	A300V	probably damaging	Het
Pde9a	G	T	17: 31,443,887	V97L	probably benign	Het
Rfc5	T	A	5: 117,387,866		probably null	Het
Rnf145	T	C	11: 44,564,277	S662P	probably benign	Het
Rsf1	G	A	7: 97,579,910		probably benign	Het
Scfd2	A	G	5: 74,482,209	V359A	probably damaging	Het
Skp2	T	C	15: 9,139,428		probably null	Het
St3gal1	A	G	15: 67,111,346	V187A	possibly damaging	Het
Tekt2	T	C	4: 126,324,317	E134G	probably damaging	Het
Vmn1r4	T	C	6: 56,956,784	I91T	probably damaging	Het
Vmn2r93	T	C	17: 18,316,587	S511P	probably damaging	Het
Vps50	T	C	6: 3,592,577		probably null	Het
Zeb2	T	G	2: 44,988,799	E1141A	probably damaging	Het
Zfp326	T	A	5: 105,911,493	Y373*	probably null	Het

Other mutations in Ttll4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01606:Ttll4	APN	1	74685893	missense	probably damaging	1.00
IGL01743:Ttll4	APN	1	74688193	missense	possibly damaging	0.63
IGL01914:Ttll4	APN	1	74679058	missense	probably benign	0.01
IGL02288:Ttll4	APN	1	74679401	missense	probably benign	0.05
IGL02621:Ttll4	APN	1	74687484	missense	probably damaging	1.00
IGL02662:Ttll4	APN	1	74687231	splice site	probably null
IGL02890:Ttll4	APN	1	74687339	nonsense	probably null
IGL02937:Ttll4	APN	1	74679503	missense	possibly damaging	0.92
IGL03178:Ttll4	APN	1	74680408	missense	probably damaging	0.96
IGL03412:Ttll4	APN	1	74687321	missense	probably benign	0.28
1mM(1):Ttll4	UTSW	1	74689980	missense	probably null	1.00
R0083:Ttll4	UTSW	1	74679769	missense	probably benign	0.13
R0108:Ttll4	UTSW	1	74679769	missense	probably benign	0.13
R0135:Ttll4	UTSW	1	74679928	missense	possibly damaging	0.86
R0137:Ttll4	UTSW	1	74679692	missense	possibly damaging	0.74
R0306:Ttll4	UTSW	1	74696757	missense	probably benign	0.28
R0506:Ttll4	UTSW	1	74688618	missense	probably benign	0.06
R0555:Ttll4	UTSW	1	74688280	missense	probably damaging	1.00
R1617:Ttll4	UTSW	1	74679401	missense	probably benign	0.05
R1649:Ttll4	UTSW	1	74697470	missense	possibly damaging	0.52
R1793:Ttll4	UTSW	1	74687840	missense	possibly damaging	0.91
R1898:Ttll4	UTSW	1	74697482	missense	probably benign	0.01
R1952:Ttll4	UTSW	1	74687559	missense	probably damaging	0.99
R1987:Ttll4	UTSW	1	74685368	missense	possibly damaging	0.81
R1989:Ttll4	UTSW	1	74685368	missense	possibly damaging	0.81
R2067:Ttll4	UTSW	1	74680382	missense	possibly damaging	0.94
R2162:Ttll4	UTSW	1	74686391	missense	probably damaging	1.00
R2185:Ttll4	UTSW	1	74679829	missense	possibly damaging	0.54
R2875:Ttll4	UTSW	1	74686438	splice site	probably null
R2876:Ttll4	UTSW	1	74686438	splice site	probably null
R2895:Ttll4	UTSW	1	74685358	missense	possibly damaging	0.92
R2896:Ttll4	UTSW	1	74685358	missense	possibly damaging	0.92
R3157:Ttll4	UTSW	1	74697611	missense	possibly damaging	0.81
R3832:Ttll4	UTSW	1	74686391	missense	probably damaging	1.00
R4707:Ttll4	UTSW	1	74679007	missense	possibly damaging	0.62
R4784:Ttll4	UTSW	1	74679007	missense	possibly damaging	0.62
R4785:Ttll4	UTSW	1	74679007	missense	possibly damaging	0.62
R5176:Ttll4	UTSW	1	74679286	missense	probably damaging	0.99
R5202:Ttll4	UTSW	1	74687852	critical splice donor site	probably null
R5244:Ttll4	UTSW	1	74696448	missense	probably benign	0.30
R5264:Ttll4	UTSW	1	74686376	missense	possibly damaging	0.92
R5452:Ttll4	UTSW	1	74679321	missense	probably benign	0.06
R5992:Ttll4	UTSW	1	74685391	missense	probably damaging	1.00
R6111:Ttll4	UTSW	1	74697539	missense	possibly damaging	0.95
R6722:Ttll4	UTSW	1	74681789	missense	possibly damaging	0.95
R6776:Ttll4	UTSW	1	74681353	missense	probably damaging	1.00
R6815:Ttll4	UTSW	1	74679349	missense	possibly damaging	0.89
R6836:Ttll4	UTSW	1	74689413	missense	probably damaging	0.98
R7271:Ttll4	UTSW	1	74688661	missense	possibly damaging	0.83
R7508:Ttll4	UTSW	1	74687259	missense	possibly damaging	0.81
R7714:Ttll4	UTSW	1	74679413	missense	probably benign	0.00
R7837:Ttll4	UTSW	1	74681757	critical splice acceptor site	probably null
R8032:Ttll4	UTSW	1	74696473	missense	possibly damaging	0.82
R8036:Ttll4	UTSW	1	74679230	missense	probably benign	0.02
R8115:Ttll4	UTSW	1	74687330	nonsense	probably null
R8949:Ttll4	UTSW	1	74681816	missense	probably damaging	0.99
R9145:Ttll4	UTSW	1	74679790	missense	probably benign	0.02
R9156:Ttll4	UTSW	1	74680066	missense	probably benign	0.00
R9329:Ttll4	UTSW	1	74685962	missense	possibly damaging	0.85
R9701:Ttll4	UTSW	1	74681323	missense	probably benign	0.07
R9802:Ttll4	UTSW	1	74681323	missense	probably benign	0.07

Predicted Primers

PCR Primer
(F):5'- TCCATCAAGAAGGGCAGTGC -3'
(R):5'- TGCTTTCAGTATCTCTTGACATAGC -3'

Sequencing Primer
(F):5'- CTCGTGATGCTCAGTACCAGTCAG -3'
(R):5'- GCCTGATCTACATAGTGAGTTCCAG -3'

Posted On

2018-11-28