Incidental Mutation 'R4588:Vps50'
ID342608
Institutional Source Beutler Lab
Gene Symbol Vps50
Ensembl Gene ENSMUSG00000001376
Gene NameVPS50 EARP/GARPII complex subunit
Synonyms8430415E05Rik, 1700034M03Rik, Ccdc132
MMRRC Submission 042007-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.843) question?
Stock #R4588 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location3498382-3603531 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3562306 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 467 (E467G)
Ref Sequence ENSEMBL: ENSMUSP00000128323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001412] [ENSMUST00000164052] [ENSMUST00000170873]
Predicted Effect probably damaging
Transcript: ENSMUST00000001412
AA Change: E467G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001412
Gene: ENSMUSG00000001376
AA Change: E467G

DomainStartEndE-ValueType
Pfam:DUF2450 54 345 2.5e-112 PFAM
low complexity region 659 676 N/A INTRINSIC
Pfam:DUF2451 723 957 2.2e-98 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164052
AA Change: E467G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125872
Gene: ENSMUSG00000001376
AA Change: E467G

DomainStartEndE-ValueType
Pfam:DUF2450 54 345 5.2e-111 PFAM
low complexity region 659 676 N/A INTRINSIC
Pfam:DUF2451 723 929 1.1e-90 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170873
AA Change: E467G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128323
Gene: ENSMUSG00000001376
AA Change: E467G

DomainStartEndE-ValueType
Pfam:DUF2450 54 345 5.3e-111 PFAM
low complexity region 659 676 N/A INTRINSIC
Pfam:DUF2451 723 933 2.6e-90 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184461
Meta Mutation Damage Score 0.6915 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 G T 10: 79,997,867 probably null Het
Abcb4 A T 5: 8,947,328 I936F probably benign Het
Adnp2 G T 18: 80,128,648 L849I probably benign Het
Atf7ip T C 6: 136,599,694 S1032P probably benign Het
Atr A C 9: 95,865,667 D334A probably benign Het
Atrip A T 9: 109,060,279 D20E probably damaging Het
Atxn7 T A 14: 14,096,268 C43* probably null Het
Cfap65 C A 1: 74,904,056 Q1603H possibly damaging Het
Cpne5 T C 17: 29,164,713 I327V probably benign Het
Ctsa T C 2: 164,834,150 S41P possibly damaging Het
Cyp4x1 A T 4: 115,108,797 L444Q probably damaging Het
Dchs1 C A 7: 105,756,041 M2431I probably benign Het
Ddi1 T A 9: 6,266,003 H122L probably benign Het
Defa21 C T 8: 21,025,648 P21S probably damaging Het
Ect2 A G 3: 27,147,000 V77A probably damaging Het
Ermap C A 4: 119,188,248 probably benign Het
Fancm G A 12: 65,118,441 probably null Het
Gcnt3 T A 9: 70,034,230 D352V probably damaging Het
Gys2 A G 6: 142,449,455 M428T possibly damaging Het
Igtp T A 11: 58,206,682 N226K probably damaging Het
Itpr2 T A 6: 146,241,196 H1675L probably benign Het
Lipo4 G A 19: 33,499,247 P367L possibly damaging Het
Lzts3 T C 2: 130,634,766 *587W probably null Het
Mast3 T A 8: 70,780,607 K300* probably null Het
Mepce G A 5: 137,785,272 T264I possibly damaging Het
Mif4gd A T 11: 115,609,546 I62N probably damaging Het
Olfr307 C T 7: 86,335,644 V251I probably benign Het
Olfr869 T A 9: 20,138,087 *324K probably null Het
Palm3 A G 8: 84,029,386 K509R probably benign Het
Pde11a T C 2: 76,029,303 T821A probably damaging Het
Pik3r5 A G 11: 68,493,261 probably benign Het
Pkhd1 T C 1: 20,200,868 T3154A probably benign Het
Ptprs A G 17: 56,425,534 Y438H probably damaging Het
Rdh8 T A 9: 20,822,729 D70E probably benign Het
Scn2a A T 2: 65,713,767 I831L possibly damaging Het
Selenoo A G 15: 89,096,718 H420R probably benign Het
Slc22a16 T C 10: 40,570,681 probably benign Het
Slc5a1 A G 5: 33,145,288 T208A probably benign Het
Sparc T C 11: 55,405,236 M121V probably benign Het
Sstr1 G T 12: 58,213,631 A347S probably benign Het
Stab1 C A 14: 31,157,445 V693F probably benign Het
Tnn A G 1: 160,145,111 V307A probably benign Het
Trmt1 A G 8: 84,690,753 probably benign Het
Ttc3 T C 16: 94,442,901 S1255P probably benign Het
Ube2ql1 A C 13: 69,739,157 S62A unknown Het
Vmn2r84 T A 10: 130,385,940 M804L probably damaging Het
Vps13a T C 19: 16,640,039 T3002A probably damaging Het
Other mutations in Vps50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Vps50 APN 6 3602670 missense probably benign 0.00
IGL00764:Vps50 APN 6 3532177 nonsense probably null
IGL00844:Vps50 APN 6 3532177 nonsense probably null
IGL00845:Vps50 APN 6 3532177 nonsense probably null
IGL00850:Vps50 APN 6 3532177 nonsense probably null
IGL01417:Vps50 APN 6 3522377 splice site probably benign
IGL01648:Vps50 APN 6 3498545 missense probably benign 0.25
IGL03238:Vps50 APN 6 3594771 missense possibly damaging 0.60
IGL03285:Vps50 APN 6 3555011 missense possibly damaging 0.71
R0309:Vps50 UTSW 6 3536853 missense possibly damaging 0.90
R0513:Vps50 UTSW 6 3520210 missense probably damaging 1.00
R0714:Vps50 UTSW 6 3571105 missense probably benign 0.05
R1066:Vps50 UTSW 6 3533565 missense probably damaging 1.00
R1210:Vps50 UTSW 6 3594884 missense probably damaging 0.99
R1420:Vps50 UTSW 6 3588007 nonsense probably null
R1437:Vps50 UTSW 6 3517852 nonsense probably null
R1451:Vps50 UTSW 6 3565628 missense possibly damaging 0.77
R1470:Vps50 UTSW 6 3517777 splice site probably benign
R1576:Vps50 UTSW 6 3545568 missense possibly damaging 0.60
R1599:Vps50 UTSW 6 3565537 missense probably benign 0.00
R1860:Vps50 UTSW 6 3520279 critical splice donor site probably null
R2055:Vps50 UTSW 6 3522265 missense probably benign 0.01
R2109:Vps50 UTSW 6 3555379 missense probably damaging 0.99
R3408:Vps50 UTSW 6 3600212 missense probably damaging 1.00
R3732:Vps50 UTSW 6 3519243 synonymous silent
R3764:Vps50 UTSW 6 3588063 missense probably damaging 1.00
R3828:Vps50 UTSW 6 3533500 missense probably benign
R4092:Vps50 UTSW 6 3551037 missense probably benign
R4385:Vps50 UTSW 6 3516694 missense probably benign 0.00
R4843:Vps50 UTSW 6 3536974 critical splice donor site probably null
R4978:Vps50 UTSW 6 3517808 missense probably benign
R5368:Vps50 UTSW 6 3567739 missense possibly damaging 0.88
R5867:Vps50 UTSW 6 3536965 missense probably damaging 1.00
R6591:Vps50 UTSW 6 3504939 critical splice donor site probably null
R6626:Vps50 UTSW 6 3551101 nonsense probably null
R6691:Vps50 UTSW 6 3504939 critical splice donor site probably null
R6707:Vps50 UTSW 6 3545583 missense probably damaging 1.00
R6751:Vps50 UTSW 6 3600274 missense probably damaging 1.00
R6773:Vps50 UTSW 6 3592560 missense probably benign 0.25
R6867:Vps50 UTSW 6 3517835 missense probably benign 0.16
R6883:Vps50 UTSW 6 3498513 unclassified probably benign
R6963:Vps50 UTSW 6 3592577 critical splice donor site probably null
R7147:Vps50 UTSW 6 3567750 nonsense probably null
R7150:Vps50 UTSW 6 3578854 missense possibly damaging 0.89
R7167:Vps50 UTSW 6 3600256 missense probably damaging 1.00
R7235:Vps50 UTSW 6 3588078 missense probably benign 0.01
R7385:Vps50 UTSW 6 3602708 missense probably benign 0.00
R7662:Vps50 UTSW 6 3562304 missense probably damaging 1.00
R7782:Vps50 UTSW 6 3532202 critical splice donor site probably null
R8188:Vps50 UTSW 6 3562297 nonsense probably null
R8232:Vps50 UTSW 6 3600139 missense probably damaging 1.00
R8535:Vps50 UTSW 6 3565612 missense possibly damaging 0.95
R8808:Vps50 UTSW 6 3522338 nonsense probably null
R8845:Vps50 UTSW 6 3504926 missense probably benign
X0025:Vps50 UTSW 6 3571012 missense probably benign 0.02
X0062:Vps50 UTSW 6 3594833 missense probably benign
Z1176:Vps50 UTSW 6 3578792 critical splice acceptor site probably null
Z1177:Vps50 UTSW 6 3555367 critical splice acceptor site probably null
Z1177:Vps50 UTSW 6 3562312 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTAACAGAAGCCAGCGTG -3'
(R):5'- TGGATAATTCCTACAAAAGGGCC -3'

Sequencing Primer
(F):5'- CTAACAGAAGCCAGCGTGTGTAG -3'
(R):5'- TTCCTACAAAAGGGCCTGCTAGG -3'
Posted On2015-09-24