Incidental Mutation 'R7003:P2rx5'
ID544681
Institutional Source Beutler Lab
Gene Symbol P2rx5
Ensembl Gene ENSMUSG00000005950
Gene Namepurinergic receptor P2X, ligand-gated ion channel, 5
SynonymsP2X5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R7003 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location73160421-73172685 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 73167974 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000121834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006104] [ENSMUST00000135202] [ENSMUST00000136894]
Predicted Effect probably null
Transcript: ENSMUST00000006104
SMART Domains Protein: ENSMUSP00000006104
Gene: ENSMUSG00000005950

DomainStartEndE-ValueType
Pfam:P2X_receptor 14 382 2.1e-161 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000135202
SMART Domains Protein: ENSMUSP00000118448
Gene: ENSMUSG00000005950

DomainStartEndE-ValueType
Pfam:P2X_receptor 14 307 1.8e-120 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000136894
SMART Domains Protein: ENSMUSP00000121834
Gene: ENSMUSG00000005950

DomainStartEndE-ValueType
Pfam:P2X_receptor 14 331 2.9e-144 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring downstream gene, TAX1BP3 (Tax1 binding protein 3). [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygous mutant mice exhibit decreased peripheral blood CD8+ lymphocytes and elevated NK cells. Impaired learning/memory during trace aversive conditioning and increased exploratory behavior during open field testing is also seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T G 15: 8,228,762 L2164R probably damaging Het
Actbl2 T A 13: 111,255,956 I275N probably damaging Het
Actr3b A C 5: 25,798,463 Y21S probably damaging Het
Adam6b C T 12: 113,490,042 Q160* probably null Het
Adgrv1 C T 13: 81,522,104 probably null Het
Akr1c6 A G 13: 4,454,515 N300D probably benign Het
Alox8 T C 11: 69,191,590 D170G possibly damaging Het
Amhr2 A G 15: 102,446,333 N40S probably benign Het
Ap2a2 A G 7: 141,629,196 N767S probably benign Het
Armc3 T C 2: 19,270,028 I358T probably damaging Het
Atg2b A G 12: 105,654,249 S732P probably benign Het
Atp12a A G 14: 56,373,380 Y327C possibly damaging Het
Bcr T C 10: 75,061,561 V179A probably benign Het
Cep104 T C 4: 153,993,561 L642P probably benign Het
Clspn T A 4: 126,592,720 S1302R possibly damaging Het
Cmip T C 8: 117,384,988 F153L probably benign Het
D630039A03Rik T C 4: 57,910,521 D97G probably damaging Het
Dok7 A T 5: 35,079,555 T396S probably benign Het
Dsel C T 1: 111,860,295 V837I probably benign Het
Etl4 C T 2: 20,805,884 T926I probably benign Het
Gm7102 A G 19: 61,175,881 S39P possibly damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Gpr155 A G 2: 73,343,617 I816T probably damaging Het
Hpn C T 7: 31,110,942 probably benign Het
Inpp5e A G 2: 26,397,865 S640P probably benign Het
Irs3 C T 5: 137,645,277 V82I probably benign Het
Kif16b A C 2: 142,758,829 D461E possibly damaging Het
Krba1 A G 6: 48,413,080 T592A possibly damaging Het
Lgsn T A 1: 31,203,943 S369T possibly damaging Het
Lrrc4b C T 7: 44,445,156 P83S probably damaging Het
Neil3 T C 8: 53,600,966 T343A possibly damaging Het
Nt5e A G 9: 88,364,752 Y347C probably damaging Het
Olfr1532-ps1 A T 7: 106,915,112 T305S probably benign Het
Olfr3 A G 2: 36,813,035 I19T possibly damaging Het
Olfr452 C T 6: 42,790,465 T142I probably benign Het
Olfr943 A T 9: 39,184,943 Y255F probably benign Het
Phtf2 A G 5: 20,794,401 V248A probably benign Het
Plekhd1 T C 12: 80,721,960 C406R possibly damaging Het
Plod3 T A 5: 136,989,644 N245K probably damaging Het
Polr3c G T 3: 96,723,638 H155Q possibly damaging Het
Psap T A 10: 60,299,497 C317S probably damaging Het
Rif1 A G 2: 52,076,989 I97V probably benign Het
Rnf123 T A 9: 108,063,683 probably null Het
Rnf19a G A 15: 36,254,504 R303* probably null Het
Sdk1 G A 5: 142,096,734 V1036I probably benign Het
Shc3 T A 13: 51,466,552 Y146F probably benign Het
Skint6 A G 4: 113,105,912 Y441H probably benign Het
Slc7a12 T C 3: 14,505,520 I173T probably damaging Het
Spesp1 A T 9: 62,282,020 S15T possibly damaging Het
Tarm1 A T 7: 3,497,423 probably null Het
Tenm3 T C 8: 48,240,444 Y1817C probably damaging Het
Ttc9c A T 19: 8,818,540 L45Q probably damaging Het
Ube3a C T 7: 59,276,440 T322I probably damaging Het
Vac14 T A 8: 110,712,798 V669E probably damaging Het
Vmn1r225 A G 17: 20,503,154 M286V probably null Het
Zfp658 A G 7: 43,574,748 K816E possibly damaging Het
Zfp846 T C 9: 20,587,892 M1T probably null Het
Other mutations in P2rx5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:P2rx5 APN 11 73167492 critical splice acceptor site probably null
IGL01860:P2rx5 APN 11 73165559 missense probably damaging 0.98
IGL02019:P2rx5 APN 11 73167977 splice site probably benign
IGL03079:P2rx5 APN 11 73164888 missense possibly damaging 0.92
IGL03088:P2rx5 APN 11 73165620 splice site probably benign
R0014:P2rx5 UTSW 11 73167062 splice site probably benign
R0845:P2rx5 UTSW 11 73165574 missense probably damaging 1.00
R1384:P2rx5 UTSW 11 73167890 missense probably damaging 1.00
R3415:P2rx5 UTSW 11 73160660 missense possibly damaging 0.94
R4155:P2rx5 UTSW 11 73171829 missense probably damaging 0.96
R4641:P2rx5 UTSW 11 73167564 missense possibly damaging 0.58
R4750:P2rx5 UTSW 11 73164877 missense probably damaging 1.00
R4854:P2rx5 UTSW 11 73171779 missense probably benign 0.23
R5186:P2rx5 UTSW 11 73171790 missense possibly damaging 0.68
R7141:P2rx5 UTSW 11 73160648 missense probably damaging 1.00
R7312:P2rx5 UTSW 11 73164866 missense probably damaging 1.00
X0004:P2rx5 UTSW 11 73166989 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGTATTGCTGAGACTCCC -3'
(R):5'- AGTGACTTCCCTGTCCCTAG -3'

Sequencing Primer
(F):5'- CCCCAAGCTTTGTAAAGGTACAGG -3'
(R):5'- TGTCCCTAGGGAGCCAGTAAG -3'
Posted On2019-05-13