Incidental Mutation 'R7003:Skint6'
ID544651
Institutional Source Beutler Lab
Gene Symbol Skint6
Ensembl Gene ENSMUSG00000087194
Gene Nameselection and upkeep of intraepithelial T cells 6
SynonymsOTTMUSG00000008519
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R7003 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location112804616-113286973 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113105912 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 441 (Y441H)
Ref Sequence ENSEMBL: ENSMUSP00000132312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000138966] [ENSMUST00000171224]
Predicted Effect probably benign
Transcript: ENSMUST00000138966
AA Change: Y441H

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000121870
Gene: ENSMUSG00000087194
AA Change: Y441H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGv 44 125 2.32e-8 SMART
internal_repeat_1 219 594 1.11e-41 PROSPERO
low complexity region 601 610 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
internal_repeat_1 701 1076 1.11e-41 PROSPERO
transmembrane domain 1087 1104 N/A INTRINSIC
transmembrane domain 1164 1186 N/A INTRINSIC
transmembrane domain 1206 1228 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171224
AA Change: Y441H

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000132312
Gene: ENSMUSG00000087194
AA Change: Y441H

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGv 44 125 2.32e-8 SMART
internal_repeat_1 219 594 1.11e-41 PROSPERO
low complexity region 601 610 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
internal_repeat_1 701 1076 1.11e-41 PROSPERO
transmembrane domain 1087 1104 N/A INTRINSIC
transmembrane domain 1164 1186 N/A INTRINSIC
transmembrane domain 1206 1228 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T G 15: 8,228,762 L2164R probably damaging Het
Actbl2 T A 13: 111,255,956 I275N probably damaging Het
Actr3b A C 5: 25,798,463 Y21S probably damaging Het
Adam6b C T 12: 113,490,042 Q160* probably null Het
Adgrv1 C T 13: 81,522,104 probably null Het
Akr1c6 A G 13: 4,454,515 N300D probably benign Het
Alox8 T C 11: 69,191,590 D170G possibly damaging Het
Amhr2 A G 15: 102,446,333 N40S probably benign Het
Ap2a2 A G 7: 141,629,196 N767S probably benign Het
Armc3 T C 2: 19,270,028 I358T probably damaging Het
Atg2b A G 12: 105,654,249 S732P probably benign Het
Atp12a A G 14: 56,373,380 Y327C possibly damaging Het
Bcr T C 10: 75,061,561 V179A probably benign Het
Cep104 T C 4: 153,993,561 L642P probably benign Het
Clspn T A 4: 126,592,720 S1302R possibly damaging Het
Cmip T C 8: 117,384,988 F153L probably benign Het
D630039A03Rik T C 4: 57,910,521 D97G probably damaging Het
Dok7 A T 5: 35,079,555 T396S probably benign Het
Dsel C T 1: 111,860,295 V837I probably benign Het
Etl4 C T 2: 20,805,884 T926I probably benign Het
Gm7102 A G 19: 61,175,881 S39P possibly damaging Het
Gpatch2l G A 12: 86,244,184 R47H probably damaging Het
Gpr155 A G 2: 73,343,617 I816T probably damaging Het
Hpn C T 7: 31,110,942 probably benign Het
Inpp5e A G 2: 26,397,865 S640P probably benign Het
Irs3 C T 5: 137,645,277 V82I probably benign Het
Kif16b A C 2: 142,758,829 D461E possibly damaging Het
Krba1 A G 6: 48,413,080 T592A possibly damaging Het
Lgsn T A 1: 31,203,943 S369T possibly damaging Het
Lrrc4b C T 7: 44,445,156 P83S probably damaging Het
Neil3 T C 8: 53,600,966 T343A possibly damaging Het
Nt5e A G 9: 88,364,752 Y347C probably damaging Het
Olfr1532-ps1 A T 7: 106,915,112 T305S probably benign Het
Olfr3 A G 2: 36,813,035 I19T possibly damaging Het
Olfr452 C T 6: 42,790,465 T142I probably benign Het
Olfr943 A T 9: 39,184,943 Y255F probably benign Het
P2rx5 T C 11: 73,167,974 probably null Het
Phtf2 A G 5: 20,794,401 V248A probably benign Het
Plekhd1 T C 12: 80,721,960 C406R possibly damaging Het
Plod3 T A 5: 136,989,644 N245K probably damaging Het
Polr3c G T 3: 96,723,638 H155Q possibly damaging Het
Psap T A 10: 60,299,497 C317S probably damaging Het
Rif1 A G 2: 52,076,989 I97V probably benign Het
Rnf123 T A 9: 108,063,683 probably null Het
Rnf19a G A 15: 36,254,504 R303* probably null Het
Sdk1 G A 5: 142,096,734 V1036I probably benign Het
Shc3 T A 13: 51,466,552 Y146F probably benign Het
Slc7a12 T C 3: 14,505,520 I173T probably damaging Het
Spesp1 A T 9: 62,282,020 S15T possibly damaging Het
Tarm1 A T 7: 3,497,423 probably null Het
Tenm3 T C 8: 48,240,444 Y1817C probably damaging Het
Ttc9c A T 19: 8,818,540 L45Q probably damaging Het
Ube3a C T 7: 59,276,440 T322I probably damaging Het
Vac14 T A 8: 110,712,798 V669E probably damaging Het
Vmn1r225 A G 17: 20,503,154 M286V probably null Het
Zfp658 A G 7: 43,574,748 K816E possibly damaging Het
Zfp846 T C 9: 20,587,892 M1T probably null Het
Other mutations in Skint6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Skint6 APN 4 112804682 missense possibly damaging 0.96
IGL01296:Skint6 APN 4 113236440 missense probably benign 0.37
IGL01343:Skint6 APN 4 113283626 missense probably benign 0.07
IGL01543:Skint6 APN 4 112899963 missense probably benign 0.18
IGL01633:Skint6 APN 4 113238049 missense probably damaging 1.00
IGL01818:Skint6 APN 4 112948569 missense probably benign 0.18
IGL02124:Skint6 APN 4 113087796 missense probably benign
IGL02517:Skint6 APN 4 112948540 splice site probably benign
IGL02647:Skint6 APN 4 113127891 splice site probably benign
IGL02887:Skint6 APN 4 113238184 nonsense probably null
IGL03026:Skint6 APN 4 112991244 splice site probably null
IGL03030:Skint6 APN 4 113012956 missense probably benign 0.03
PIT4576001:Skint6 UTSW 4 113053367 missense possibly damaging 0.91
R0058:Skint6 UTSW 4 113046815 splice site probably benign
R0058:Skint6 UTSW 4 113046815 splice site probably benign
R0099:Skint6 UTSW 4 112811501 missense possibly damaging 0.53
R0158:Skint6 UTSW 4 113184814 splice site probably benign
R0164:Skint6 UTSW 4 112991236 splice site probably benign
R0312:Skint6 UTSW 4 112809100 missense possibly damaging 0.86
R0591:Skint6 UTSW 4 112858169 splice site probably benign
R0762:Skint6 UTSW 4 112865651 splice site probably benign
R0941:Skint6 UTSW 4 113238358 missense probably damaging 1.00
R1023:Skint6 UTSW 4 113238103 missense probably benign 0.20
R1132:Skint6 UTSW 4 112898099 critical splice donor site probably null
R1228:Skint6 UTSW 4 112854452 missense probably benign
R1338:Skint6 UTSW 4 113012961 missense possibly damaging 0.53
R1432:Skint6 UTSW 4 112869524 splice site probably benign
R1512:Skint6 UTSW 4 113238132 missense probably damaging 1.00
R1577:Skint6 UTSW 4 113148523 missense possibly damaging 0.53
R1733:Skint6 UTSW 4 113177037 splice site probably benign
R1762:Skint6 UTSW 4 113236481 missense probably damaging 0.98
R1891:Skint6 UTSW 4 112846696 missense possibly damaging 0.85
R1908:Skint6 UTSW 4 112891990 missense probably benign
R2069:Skint6 UTSW 4 113238132 missense probably damaging 1.00
R2089:Skint6 UTSW 4 112846684 missense probably benign
R2091:Skint6 UTSW 4 112846684 missense probably benign
R2091:Skint6 UTSW 4 112846684 missense probably benign
R2144:Skint6 UTSW 4 113236260 missense possibly damaging 0.84
R2166:Skint6 UTSW 4 112854452 missense probably benign 0.01
R2192:Skint6 UTSW 4 112865712 nonsense probably null
R2267:Skint6 UTSW 4 112842822 intron probably null
R2312:Skint6 UTSW 4 113238142 missense probably damaging 1.00
R2324:Skint6 UTSW 4 112872457 splice site probably null
R2342:Skint6 UTSW 4 113176983 missense probably benign 0.00
R3028:Skint6 UTSW 4 113236493 missense possibly damaging 0.92
R3704:Skint6 UTSW 4 113136472 missense possibly damaging 0.86
R3752:Skint6 UTSW 4 112842899 splice site probably benign
R3760:Skint6 UTSW 4 112937458 missense possibly damaging 0.53
R3827:Skint6 UTSW 4 112937437 missense probably benign
R4377:Skint6 UTSW 4 113236518 missense possibly damaging 0.90
R4406:Skint6 UTSW 4 113156486 missense probably benign 0.01
R4611:Skint6 UTSW 4 113074076 missense probably benign
R4780:Skint6 UTSW 4 113236397 missense probably damaging 0.98
R4788:Skint6 UTSW 4 113238336 missense possibly damaging 0.54
R4818:Skint6 UTSW 4 112955392 intron probably benign
R4900:Skint6 UTSW 4 113067470 missense probably benign 0.03
R4972:Skint6 UTSW 4 112835068 missense probably benign
R5008:Skint6 UTSW 4 112991255 missense possibly damaging 0.86
R5016:Skint6 UTSW 4 113171533 critical splice acceptor site probably null
R5085:Skint6 UTSW 4 113236268 missense probably damaging 0.99
R5165:Skint6 UTSW 4 112865668 missense possibly damaging 0.86
R5221:Skint6 UTSW 4 112894924 intron probably null
R5310:Skint6 UTSW 4 113184768 nonsense probably null
R5423:Skint6 UTSW 4 112850740 missense possibly damaging 0.93
R5436:Skint6 UTSW 4 113096591 missense probably benign 0.08
R5447:Skint6 UTSW 4 113105909 missense probably benign 0.34
R5564:Skint6 UTSW 4 112988965 missense possibly damaging 0.72
R5629:Skint6 UTSW 4 113012979 missense possibly damaging 0.86
R5936:Skint6 UTSW 4 113096593 missense probably benign 0.33
R5993:Skint6 UTSW 4 112809079 missense probably benign 0.02
R6027:Skint6 UTSW 4 113096564 splice site probably null
R6174:Skint6 UTSW 4 112839313 missense possibly damaging 0.53
R6497:Skint6 UTSW 4 113236398 missense probably damaging 0.98
R6552:Skint6 UTSW 4 113067490 missense possibly damaging 0.86
R6645:Skint6 UTSW 4 112892038 missense possibly damaging 0.53
R6810:Skint6 UTSW 4 112948380 intron probably null
R7211:Skint6 UTSW 4 113238369 missense probably benign 0.09
R7269:Skint6 UTSW 4 112854489 intron probably null
R7398:Skint6 UTSW 4 112898138 missense probably benign 0.00
R7438:Skint6 UTSW 4 113238228 missense probably damaging 1.00
R7536:Skint6 UTSW 4 112811547 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AATCGAGCACATATGTCAATGCCAT -3'
(R):5'- TGGGACAAAGAACATAGGTCCAA -3'

Sequencing Primer
(F):5'- CACATATGTCAATGCCATTTACTTTG -3'
(R):5'- CCTCACAGTGAAAAATGCAAGTTG -3'
Posted On2019-05-13