Mutagenetix > Incidental Mutations

Incidental Mutation 'R7023:Cpvl'

545761

Institutional Source

Beutler Lab

Gene Symbol

Cpvl

Ensembl Gene

ENSMUSG00000052955

Gene Name

carboxypeptidase, vitellogenic-like

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.072) question?

Stock #

R7023 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

53873279-53978671 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 53967812 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 80 (I80F)

Ref Sequence

ENSEMBL: ENSMUSP00000144942 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166545] [ENSMUST00000203101] [ENSMUST00000204674]

Predicted Effect

probably benign
Transcript: ENSMUST00000166545
AA Change: I80F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000131462
Gene: ENSMUSG00000052955
AA Change: I80F

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Peptidase_S10	66	470	3.5e-106	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000203101
AA Change: I80F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000145288
Gene: ENSMUSG00000052955
AA Change: I80F

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Peptidase_S10	66	266	3.8e-68	PFAM
Pfam:Peptidase_S10	262	426	5.2e-30	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000204674
AA Change: I80F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000144942
Gene: ENSMUSG00000052955
AA Change: I80F

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Peptidase_S10	66	470	3.5e-106	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the serine carboxypeptidase family of proteases that cleave amino acids from the C-terminus of a protein substrate. The human ortholog of this gene, where it was first characterized, was found to be upregulated during the maturation of monocytes to macrophages. The encoded protein may be involved in antigen processing, digestion of phagocytosed proteins in the lysosome and lamellipodium formation. Disruption of this gene in mice was found to cause embryonic lethality. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a transposon insertion allele die prior to birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833420G17Rik	A	G	13: 119,473,907	H372R	probably benign	Het
4933405O20Rik	T	C	7: 50,600,253	I345T	probably damaging	Het
4933427D14Rik	A	G	11: 72,178,403		probably null	Het
6430548M08Rik	T	C	8: 120,145,357	V8A	probably damaging	Het
9530053A07Rik	T	A	7: 28,140,038	C425*	probably null	Het
Adam2	A	T	14: 66,043,056	D501E	probably benign	Het
Agbl3	T	C	6: 34,814,769	V602A	probably benign	Het
Akap12	T	C	10: 4,356,895	M1235T	probably benign	Het
Arid5a	G	A	1: 36,317,550		probably benign	Het
Asxl1	T	A	2: 153,400,549	D1006E	probably benign	Het
AY074887	T	C	9: 54,950,865		probably benign	Het
Btbd9	T	A	17: 30,527,572	R93S	probably benign	Het
Cabp2	A	T	19: 4,082,658		probably null	Het
Cacna1e	T	C	1: 154,725,693	D76G	probably null	Het
Cd177	A	G	7: 24,759,762	I74T	probably benign	Het
Chchd1	G	A	14: 20,703,242		probably benign	Het
Col28a1	T	C	6: 8,083,763	R565G	possibly damaging	Het
Csgalnact1	T	C	8: 68,358,429	T530A	probably benign	Het
Cybrd1	A	G	2: 71,138,578	D265G	probably benign	Het
Cyp2c69	A	T	19: 39,877,542	N202K	probably benign	Het
D1Pas1	A	G	1: 186,968,008	N45D	probably damaging	Het
Dclre1a	A	G	19: 56,540,206	V839A	probably damaging	Het
Degs1	A	T	1: 182,279,065	Y210N	probably damaging	Het
Doc2g	A	G	19: 4,004,778	S220G	probably benign	Het
Epb41l2	T	A	10: 25,512,977	L885Q	probably damaging	Het
Fabp1	A	T	6: 71,203,085		probably null	Het
Fat2	G	A	11: 55,310,502	S582L	probably benign	Het
Fras1	A	G	5: 96,710,084	N2079S	probably benign	Het
Gdf6	T	C	4: 9,860,210	Y431H	probably damaging	Het
Gfra1	A	T	19: 58,454,332	L6Q	probably damaging	Het
Gm45861	T	G	8: 27,581,006	S1305A	unknown	Het
Gse1	T	C	8: 120,230,648		probably benign	Het
Kmt2e	A	G	5: 23,500,487	H1303R	possibly damaging	Het
Lck	T	C	4: 129,548,865	D499G	possibly damaging	Het
Lepr	A	T	4: 101,789,287	Y805F	probably damaging	Het
Lin7a	A	T	10: 107,382,628	Y11F	possibly damaging	Het
Lrrc43	A	G	5: 123,503,763	K559E	probably damaging	Het
Megf6	T	C	4: 154,254,145	L467P	possibly damaging	Het
Mprip	G	A	11: 59,737,389	G221R	probably damaging	Het
Myo5c	T	C	9: 75,301,456	V1683A	probably damaging	Het
Nbeal2	G	A	9: 110,638,618	R501W	probably damaging	Het
Ncf1	G	T	5: 134,225,262	A219E	possibly damaging	Het
Nckap1l	T	C	15: 103,476,066	I616T	probably benign	Het
Nlrp2	A	T	7: 5,328,229	C389*	probably null	Het
Nrg3	T	C	14: 38,376,376	E507G	probably damaging	Het
Olfr1180	A	G	2: 88,412,415	L81P	probably damaging	Het
P4ha2	A	T	11: 54,131,246	T532S	probably benign	Het
Pappa	A	T	4: 65,351,718	H1623L	probably benign	Het
Paqr6	A	G	3: 88,366,046	Y115C	probably damaging	Het
Pcolce2	A	T	9: 95,678,468	Q190L	probably benign	Het
Poll	A	G	19: 45,558,838	I65T	probably benign	Het
Prmt9	T	C	8: 77,549,457		probably benign	Het
Prpf39	T	C	12: 65,053,300	V130A	possibly damaging	Het
Prpf6	A	G	2: 181,620,640	D144G	probably damaging	Het
Rgs6	T	A	12: 83,092,104		probably benign	Het
Rimbp2	A	G	5: 128,802,783		probably null	Het
Ripor2	A	G	13: 24,671,846	T90A	probably benign	Het
Rnf150	T	C	8: 82,864,077	F23S	probably damaging	Het
Rpp40	G	A	13: 35,898,906	R200W	possibly damaging	Het
Rtp3	G	A	9: 110,986,646	S217L	probably benign	Het
Sacs	A	C	14: 61,208,815	K2770T	probably benign	Het
Scn10a	A	T	9: 119,613,544	I1545N	probably damaging	Het
Scn2b	G	T	9: 45,126,140	V162L	probably damaging	Het
Sema6d	A	G	2: 124,664,911	T880A	probably damaging	Het
Slc36a4	A	G	9: 15,719,633	D16G	probably benign	Het
Slc4a8	T	A	15: 100,791,643	I378K	probably benign	Het
Smco2	T	A	6: 146,858,856	L70*	probably null	Het
Sptb	C	T	12: 76,625,088	V364I	probably damaging	Het
Susd4	A	G	1: 182,765,048	H3R	probably damaging	Het
Tbc1d16	T	C	11: 119,158,791	Q293R	probably damaging	Het
Tnfsf9	T	A	17: 57,107,317	M248K	possibly damaging	Het
Toporsl	A	G	4: 52,611,211	N368S	possibly damaging	Het
Trip11	T	C	12: 101,885,867	E361G	probably benign	Het
Trrap	T	A	5: 144,792,154	M626K	possibly damaging	Het
Ttn	A	T	2: 76,942,874	S2395T	probably damaging	Het
Ubqln3	T	C	7: 104,141,423	R487G	probably damaging	Het
Vdac1	A	G	11: 52,374,366	Y22C	probably damaging	Het
Vmn1r59	C	T	7: 5,454,478	M94I	probably benign	Het
Vmn2r10	G	T	5: 109,002,028	D383E	probably damaging	Het
Vmn2r115	T	C	17: 23,359,811	Y753H	probably damaging	Het
Vmn2r97	G	T	17: 18,914,401	C27F	probably damaging	Het
Wasf1	T	A	10: 40,936,475	V420E	unknown	Het
Zfp94	A	T	7: 24,303,396	L201Q	probably damaging	Het
Zgpat	TGGAGGAGGAGGAGGAGGA	TGGAGGAGGAGGAGGA	2: 181,366,018		probably benign	Het
Zmym4	C	A	4: 126,868,800	R1410L	probably damaging	Het

Other mutations in Cpvl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01338:Cpvl	APN	6	53974655	missense	possibly damaging	0.92
IGL01340:Cpvl	APN	6	53896451	nonsense	probably null
IGL02596:Cpvl	APN	6	53932010	missense	probably damaging	1.00
PIT4472001:Cpvl	UTSW	6	53896479	missense	possibly damaging	0.69
R0242:Cpvl	UTSW	6	53932500	missense	possibly damaging	0.95
R0242:Cpvl	UTSW	6	53932500	missense	possibly damaging	0.95
R1586:Cpvl	UTSW	6	53926901	missense	probably damaging	1.00
R1987:Cpvl	UTSW	6	53954611	missense	probably benign	0.01
R4609:Cpvl	UTSW	6	53974620	critical splice donor site	probably null
R4664:Cpvl	UTSW	6	53931933	missense	probably benign	0.00
R4665:Cpvl	UTSW	6	53931933	missense	probably benign	0.00
R4666:Cpvl	UTSW	6	53931933	missense	probably benign	0.00
R5863:Cpvl	UTSW	6	53873428	missense	probably damaging	0.99
R5909:Cpvl	UTSW	6	53932428	missense	probably damaging	0.98
R6163:Cpvl	UTSW	6	53873518	missense	probably damaging	1.00
R6948:Cpvl	UTSW	6	53896483	missense	possibly damaging	0.94
R7262:Cpvl	UTSW	6	53932515	missense	probably damaging	1.00
R7330:Cpvl	UTSW	6	53974759	missense	probably benign	0.43
R7488:Cpvl	UTSW	6	53947742	missense	probably damaging	1.00
R7694:Cpvl	UTSW	6	53932517	nonsense	probably null
R7728:Cpvl	UTSW	6	53925290	missense	probably benign	0.00
R7750:Cpvl	UTSW	6	53926901	missense	probably damaging	1.00
R7768:Cpvl	UTSW	6	53896491	missense	possibly damaging	0.91
R7773:Cpvl	UTSW	6	53931905	critical splice donor site	probably null
R7868:Cpvl	UTSW	6	53974760	missense	possibly damaging	0.64
X0062:Cpvl	UTSW	6	53926852	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- GTGCATGCACAGGAACACAC -3'
(R):5'- CACTGTGAATGGGAAGTCTGG -3'

Sequencing Primer
(F):5'- GCACAGGAACACACCCGAAAAC -3'
(R):5'- GAACCTGTGTTCTGAGTTCCC -3'

Posted On

2019-05-13