Mutagenetix > Incidental Mutations

Incidental Mutation 'R0242:Cpvl'

59550

Institutional Source

Beutler Lab

Gene Symbol

Cpvl

Ensembl Gene

ENSMUSG00000052955

Gene Name

carboxypeptidase, vitellogenic-like

Synonyms

MMRRC Submission

038480-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.087) question?

Stock #

R0242 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

53873279-53978671 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 53932500 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 217 (H217R)

Ref Sequence

ENSEMBL: ENSMUSP00000144942 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166545] [ENSMUST00000203101] [ENSMUST00000204674]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166545
AA Change: H217R

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000131462
Gene: ENSMUSG00000052955
AA Change: H217R

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Peptidase_S10	66	470	3.5e-106	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000203101
AA Change: H217R

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000145288
Gene: ENSMUSG00000052955
AA Change: H217R

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Peptidase_S10	66	266	3.8e-68	PFAM
Pfam:Peptidase_S10	262	426	5.2e-30	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000204674
AA Change: H217R

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000144942
Gene: ENSMUSG00000052955
AA Change: H217R

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:Peptidase_S10	66	470	3.5e-106	PFAM

Meta Mutation Damage Score

0.3417

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.3%
20x: 94.5%

Validation Efficiency

97% (110/113)

MGI Phenotype

FUNCTION: This gene encodes a member of the serine carboxypeptidase family of proteases that cleave amino acids from the C-terminus of a protein substrate. The human ortholog of this gene, where it was first characterized, was found to be upregulated during the maturation of monocytes to macrophages. The encoded protein may be involved in antigen processing, digestion of phagocytosed proteins in the lysosome and lamellipodium formation. Disruption of this gene in mice was found to cause embryonic lethality. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a transposon insertion allele die prior to birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 110 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700029H14Rik	T	C	8: 13,551,676	D230G	probably benign	Het
4930435E12Rik	C	T	16: 38,824,567		probably benign	Het
Abhd13	A	G	8: 9,987,561	I53V	probably benign	Het
Adgrl2	A	C	3: 148,839,185		probably null	Het
Aldh16a1	G	A	7: 45,144,664	A596V	probably damaging	Het
Aldh3b2	T	A	19: 3,979,414	Y262*	probably null	Het
Ambn	A	G	5: 88,467,972	Q420R	possibly damaging	Het
Ankib1	A	C	5: 3,700,344		probably benign	Het
Arhgap9	C	A	10: 127,329,538	H430Q	probably benign	Het
Arhgef25	C	T	10: 127,184,064	G435E	probably damaging	Het
Armc12	A	T	17: 28,532,392	D120V	possibly damaging	Het
Armc4	A	T	18: 7,211,516	V786D	probably damaging	Het
Asxl3	G	A	18: 22,516,681	E576K	possibly damaging	Het
Bcdin3d	T	C	15: 99,470,895	E141G	probably benign	Het
Bmpr1b	G	A	3: 141,840,676	T483M	probably damaging	Het
Caprin2	C	T	6: 148,842,954	S991N	probably damaging	Het
Cd96	T	C	16: 46,071,766	I286M	possibly damaging	Het
Cdcp1	G	T	9: 123,180,172	F480L	probably benign	Het
Celf5	T	C	10: 81,464,409	T258A	probably benign	Het
Cgnl1	A	G	9: 71,721,657	V577A	probably damaging	Het
Clca3b	A	G	3: 144,841,465	S304P	probably benign	Het
Cmya5	A	T	13: 93,095,600	H993Q	probably benign	Het
Cnbp	A	T	6: 87,845,764	C6S	probably damaging	Het
Col14a1	C	T	15: 55,497,511	R1605W	probably damaging	Het
Cops7a	T	C	6: 124,964,854	N11S	probably benign	Het
Coro7	T	C	16: 4,630,178		probably benign	Het
Cuedc1	T	C	11: 88,184,621		probably benign	Het
Cyp2c66	A	G	19: 39,141,925	Y68C	probably damaging	Het
Dicer1	G	A	12: 104,702,451	T1324M	probably benign	Het
Dlgap2	A	G	8: 14,727,562	D268G	probably benign	Het
Dnm1	T	A	2: 32,316,989	M535L	possibly damaging	Het
Dock7	A	T	4: 98,962,280	F1575Y	probably benign	Het
Dpp10	T	A	1: 123,398,546	H403L	possibly damaging	Het
Dync1h1	A	G	12: 110,649,851	D3112G	possibly damaging	Het
Eno3	A	G	11: 70,657,935	E21G	probably null	Het
Fam120b	T	A	17: 15,422,924	V655D	probably damaging	Het
Fam129a	A	G	1: 151,718,216	D884G	probably benign	Het
Fkbp5	A	T	17: 28,428,452	D136E	probably benign	Het
Gdap1l1	T	A	2: 163,447,653	Y179*	probably null	Het
Gfer	A	G	17: 24,694,303	W192R	probably damaging	Het
Gm4782	A	G	6: 50,609,858	T408A	probably benign	Het
Golgb1	C	T	16: 36,875,630	Q164*	probably null	Het
Gpnmb	A	G	6: 49,047,342	N197S	probably damaging	Het
Gtf2f1	G	A	17: 57,003,802	T414M	probably benign	Het
Hc	A	G	2: 35,036,154		probably benign	Het
Hcfc1	A	T	X: 73,948,429		probably benign	Het
Helz2	C	T	2: 181,230,430	R2539Q	probably damaging	Het
Hsd17b12	T	A	2: 94,157,815	I19F	probably benign	Het
Incenp	T	C	19: 9,893,750	T172A	unknown	Het
Jmy	A	G	13: 93,441,618	Y681H	probably benign	Het
Kbtbd11	A	G	8: 15,027,508	T36A	probably benign	Het
Kcnh4	T	C	11: 100,755,699	D267G	probably damaging	Het
Krt34	C	T	11: 100,041,331	E56K	probably damaging	Het
Krt40	T	A	11: 99,538,742	E335D	probably damaging	Het
Krt86	T	A	15: 101,476,573	Y282*	probably null	Het
Lgi3	C	T	14: 70,534,815	R267*	probably null	Het
Lnpk	A	G	2: 74,537,289		probably benign	Het
Lrp1b	T	A	2: 40,998,183	H2355L	probably benign	Het
Lrrc8e	G	A	8: 4,235,401	R542H	probably benign	Het
Mia2	T	C	12: 59,108,856	Y452H	probably damaging	Het
Mmachc	C	T	4: 116,704,541	R132Q	probably damaging	Het
Mtbp	T	A	15: 55,577,486	N356K	possibly damaging	Het
Mum1	T	C	10: 80,234,258	S354P	probably benign	Het
Myo5b	A	G	18: 74,661,716	H552R	possibly damaging	Het
Noxred1	A	G	12: 87,226,979	V96A	probably benign	Het
Nr1d2	T	A	14: 18,211,933	D390V	possibly damaging	Het
Oas1e	A	T	5: 120,791,774		probably benign	Het
Olfr398	T	C	11: 73,983,712	S299G	probably benign	Het
Olfr786	T	A	10: 129,437,348	Y179N	probably damaging	Het
Otog	G	T	7: 46,267,381	C914F	probably damaging	Het
Pank2	G	T	2: 131,280,197	C214F	probably damaging	Het
Pcdhb1	T	A	18: 37,266,735	S580T	probably benign	Het
Pdia3	T	C	2: 121,414,111	S2P	probably damaging	Het
Peli1	G	T	11: 21,142,602	R83L	probably damaging	Het
Pla2g3	T	A	11: 3,491,935	C366*	probably null	Het
Pon3	T	A	6: 5,240,860	D107V	probably benign	Het
Ppip5k2	A	G	1: 97,741,091	C532R	probably damaging	Het
Prph	A	T	15: 99,055,727	D174V	probably damaging	Het
Psd3	A	G	8: 67,758,086	M270T	probably damaging	Het
Pum3	A	G	19: 27,422,755		probably benign	Het
Pus1	A	T	5: 110,779,798	H30Q	probably benign	Het
Rab7	A	T	6: 88,005,132	V87E	probably damaging	Het
Rbm5	A	T	9: 107,751,708		probably benign	Het
Reln	A	G	5: 21,942,597		probably null	Het
S1pr3	A	G	13: 51,418,902	T40A	probably benign	Het
Sdk1	T	A	5: 142,143,922		probably benign	Het
Senp7	T	A	16: 56,179,521	I853N	probably damaging	Het
Serpinb6c	T	A	13: 33,899,247		probably benign	Het
Shroom1	T	G	11: 53,465,485		probably null	Het
Slc24a3	T	C	2: 145,606,664	I376T	probably benign	Het
Slc46a1	T	C	11: 78,468,667	I375T	possibly damaging	Het
Slc4a9	T	C	18: 36,533,680	F527S	probably damaging	Het
Slc4a9	T	A	18: 36,541,233	I924N	probably damaging	Het
Slx4	T	A	16: 3,986,952	E666V	probably damaging	Het
Snrnp27	G	A	6: 86,675,593		probably benign	Het
Sorcs1	C	T	19: 50,228,221	G640E	probably damaging	Het
Sptan1	A	T	2: 30,018,401	M1725L	probably benign	Het
Sync	G	A	4: 129,293,721	R182K	probably damaging	Het
Syne2	G	A	12: 76,098,034	G1586S	probably damaging	Het
Sytl1	G	T	4: 133,253,457	T522K	probably damaging	Het
Tex2	T	A	11: 106,519,955	K414*	probably null	Het
Thegl	G	T	5: 77,016,305	E52*	probably null	Het
Thsd7a	G	A	6: 12,503,916	T413I	probably benign	Het
Tm9sf1	C	T	14: 55,637,935	A451T	possibly damaging	Het
Ttn	A	T	2: 76,826,152		probably benign	Het
Uba2	T	C	7: 34,154,629	I140V	possibly damaging	Het
Ushbp1	C	A	8: 71,390,118	G361*	probably null	Het
Wbp2nl	C	T	15: 82,313,787	A175V	probably benign	Het
Zc3h12d	A	G	10: 7,862,566	E212G	probably damaging	Het
Zc3h7b	T	C	15: 81,768,830		probably benign	Het

Other mutations in Cpvl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01338:Cpvl	APN	6	53974655	missense	possibly damaging	0.92
IGL01340:Cpvl	APN	6	53896451	nonsense	probably null
IGL02596:Cpvl	APN	6	53932010	missense	probably damaging	1.00
PIT4472001:Cpvl	UTSW	6	53896479	missense	possibly damaging	0.69
R0242:Cpvl	UTSW	6	53932500	missense	possibly damaging	0.95
R1586:Cpvl	UTSW	6	53926901	missense	probably damaging	1.00
R1987:Cpvl	UTSW	6	53954611	missense	probably benign	0.01
R4609:Cpvl	UTSW	6	53974620	critical splice donor site	probably null
R4664:Cpvl	UTSW	6	53931933	missense	probably benign	0.00
R4665:Cpvl	UTSW	6	53931933	missense	probably benign	0.00
R4666:Cpvl	UTSW	6	53931933	missense	probably benign	0.00
R5863:Cpvl	UTSW	6	53873428	missense	probably damaging	0.99
R5909:Cpvl	UTSW	6	53932428	missense	probably damaging	0.98
R6163:Cpvl	UTSW	6	53873518	missense	probably damaging	1.00
R6948:Cpvl	UTSW	6	53896483	missense	possibly damaging	0.94
R7023:Cpvl	UTSW	6	53967812	missense	probably benign	0.00
R7262:Cpvl	UTSW	6	53932515	missense	probably damaging	1.00
R7330:Cpvl	UTSW	6	53974759	missense	probably benign	0.43
R7488:Cpvl	UTSW	6	53947742	missense	probably damaging	1.00
R7694:Cpvl	UTSW	6	53932517	nonsense	probably null
R7728:Cpvl	UTSW	6	53925290	missense	probably benign	0.00
R7750:Cpvl	UTSW	6	53926901	missense	probably damaging	1.00
R7768:Cpvl	UTSW	6	53896491	missense	possibly damaging	0.91
R7773:Cpvl	UTSW	6	53931905	critical splice donor site	probably null
R7868:Cpvl	UTSW	6	53974760	missense	possibly damaging	0.64
R8670:Cpvl	UTSW	6	53974795	start codon destroyed	probably null	0.69
X0062:Cpvl	UTSW	6	53926852	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- GCTGGGATTAGCCAATCCAGACAAC -3'
(R):5'- TGTAGGACCTTCAAGGTGAGCTGAG -3'

Sequencing Primer
(F):5'- GCTGAGACAGTAAGTTGACACAC -3'
(R):5'- TTCAAGGTGAGCTGAGGAAGTG -3'

Posted On

2013-07-11