Incidental Mutation 'R0610:Hhipl1'
ID54645
Institutional Source Beutler Lab
Gene Symbol Hhipl1
Ensembl Gene ENSMUSG00000021260
Gene Namehedgehog interacting protein-like 1
Synonyms
MMRRC Submission 038799-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0610 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location108306270-108330869 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 108319402 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 490 (C490*)
Ref Sequence ENSEMBL: ENSMUSP00000021685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021685]
Predicted Effect probably null
Transcript: ENSMUST00000021685
AA Change: C490*
SMART Domains Protein: ENSMUSP00000021685
Gene: ENSMUSG00000021260
AA Change: C490*

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Folate_rec 28 189 2.4e-21 PFAM
Pfam:GSDH 199 532 3e-39 PFAM
low complexity region 619 670 N/A INTRINSIC
SR 682 785 2.01e-47 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181875
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223395
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency 99% (97/98)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the glucose/sorbosone dehydrogenase family. The encoded protein also contains a domain that binds folate and reduced folic acid derivatives. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4930578I06Rik G A 14: 63,986,265 R21* probably null Het
9530003J23Rik A G 10: 117,237,730 F66S probably benign Het
Abca15 A G 7: 120,365,786 E757G possibly damaging Het
Abca5 T C 11: 110,301,527 T720A probably benign Het
Actr5 T A 2: 158,632,456 probably null Het
Adgrl3 T C 5: 81,693,716 probably benign Het
Adra1a A G 14: 66,637,792 D72G probably damaging Het
Ahnak G T 19: 9,007,878 L2175F probably benign Het
AK157302 A G 13: 21,495,663 T120A possibly damaging Het
Apol7a G A 15: 77,389,254 A336V probably benign Het
Asic1 C A 15: 99,698,899 H525Q probably benign Het
Atxn7l2 T C 3: 108,204,774 D335G possibly damaging Het
Bpgm G T 6: 34,504,349 R227L possibly damaging Het
Calm4 T A 13: 3,838,320 V142E possibly damaging Het
Catsperg1 A T 7: 29,190,619 L721Q probably damaging Het
Cdh26 A G 2: 178,449,898 I83M probably damaging Het
Cep295 A C 9: 15,322,754 S2249A possibly damaging Het
Cln3 A G 7: 126,580,189 F139L probably damaging Het
Cmpk2 T A 12: 26,478,056 L424Q possibly damaging Het
Col12a1 A T 9: 79,707,848 V53E probably benign Het
Csmd1 G A 8: 15,918,208 R3140C possibly damaging Het
Dagla A G 19: 10,271,558 W11R probably damaging Het
Dbx2 C T 15: 95,624,897 V310M probably benign Het
Disp2 T A 2: 118,792,236 C1150S probably benign Het
Dock3 T C 9: 107,023,788 D326G probably damaging Het
Dph1 G T 11: 75,185,957 probably benign Het
Dyrk1b C A 7: 28,186,634 T594K probably damaging Het
Evx2 C A 2: 74,655,987 A353S probably benign Het
Fam71f1 T A 6: 29,326,577 V231E probably benign Het
Gm4737 T C 16: 46,153,901 E371G probably damaging Het
Gm4788 G A 1: 139,701,846 T799I probably benign Het
Greb1 A C 12: 16,696,442 S1276A probably benign Het
Hmmr G T 11: 40,715,902 T231K probably damaging Het
Hspa4l A C 3: 40,779,400 E526D probably benign Het
Ibsp A G 5: 104,310,134 E179G probably benign Het
Ift140 C T 17: 25,035,803 A150V probably benign Het
Igf2bp2 A G 16: 22,070,309 S416P probably benign Het
Ighe T C 12: 113,271,743 K294E unknown Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kng2 T A 16: 23,000,594 N231Y possibly damaging Het
Lca5 A T 9: 83,399,739 C331S probably benign Het
Lrrc1 A G 9: 77,472,206 I101T possibly damaging Het
Lrrk2 A T 15: 91,815,416 I2489L probably benign Het
Mapk9 A C 11: 49,863,573 N51T probably benign Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Nek2 T A 1: 191,822,515 V113D probably damaging Het
Nr4a3 C A 4: 48,051,903 A248E probably benign Het
Nrp1 T C 8: 128,502,618 I859T probably damaging Het
Olfm5 A T 7: 104,154,445 Y195* probably null Het
Olfr354 T A 2: 36,907,659 W238R probably damaging Het
Olfr71 T A 4: 43,706,400 H56L possibly damaging Het
Olfr955 A G 9: 39,469,823 L301P probably damaging Het
Oxtr C T 6: 112,477,177 R42Q probably benign Het
Pcnx2 A G 8: 125,839,687 W1006R probably damaging Het
Pdpk1 T C 17: 24,098,171 probably null Het
Ryr2 T A 13: 11,622,952 H3731L probably damaging Het
Sdr16c5 T G 4: 4,016,116 E103D possibly damaging Het
Setdb2 A C 14: 59,417,470 S324A possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc17a8 A T 10: 89,576,626 I499K probably damaging Het
Slc2a9 T A 5: 38,379,942 I389F probably damaging Het
Slc30a1 T C 1: 191,909,424 V394A probably damaging Het
Slc41a2 A G 10: 83,283,728 I390T possibly damaging Het
Slco1a1 A G 6: 141,918,461 probably null Het
Slit2 A G 5: 48,275,674 K1053E possibly damaging Het
Smarca2 T A 19: 26,691,391 L930Q probably damaging Het
Snx6 T C 12: 54,751,789 H387R probably damaging Het
Sox5 A T 6: 143,833,439 M622K possibly damaging Het
Ston1 C A 17: 88,635,281 N38K possibly damaging Het
Strbp C T 2: 37,584,077 V658I probably damaging Het
Strn3 T C 12: 51,610,448 probably null Het
Suco T G 1: 161,859,503 D96A probably benign Het
Suco A G 1: 161,864,032 probably benign Het
Sytl2 A T 7: 90,380,853 probably benign Het
Tmem41b T A 7: 109,981,083 M25L probably benign Het
Tmem41b T A 7: 109,981,085 D91V probably damaging Het
Tmem50b C T 16: 91,583,286 A68T probably damaging Het
Tmprss11e G A 5: 86,707,347 Q400* probably null Het
Tnfsf13b G A 8: 10,031,661 probably null Het
Trappc8 A G 18: 20,837,188 V916A probably damaging Het
Trdn G T 10: 33,474,453 V673F probably damaging Het
Trim28 G T 7: 13,025,784 probably benign Het
Txnrd2 T C 16: 18,472,882 V427A probably damaging Het
Uggt1 T C 1: 36,165,506 probably benign Het
Vmn1r36 A G 6: 66,716,420 L51P probably damaging Het
Vmn1r63 T A 7: 5,803,064 M190L possibly damaging Het
Vmn2r116 T A 17: 23,387,312 N399K probably damaging Het
Vmn2r117 T C 17: 23,475,514 N453S probably benign Het
Wbp1l T A 19: 46,654,670 I370N probably damaging Het
Zfp445 T C 9: 122,852,981 K632E probably benign Het
Zfp850 C T 7: 27,989,394 R463H probably damaging Het
Zyg11a A G 4: 108,204,857 L249P probably damaging Het
Other mutations in Hhipl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
lemon_drops UTSW 12 108311944 missense probably damaging 1.00
Rock_candy UTSW 12 108311689 missense probably damaging 1.00
R0091:Hhipl1 UTSW 12 108321897 splice site probably benign
R0180:Hhipl1 UTSW 12 108328070 missense probably damaging 1.00
R0962:Hhipl1 UTSW 12 108327721 missense probably benign 0.02
R1170:Hhipl1 UTSW 12 108311693 nonsense probably null
R1474:Hhipl1 UTSW 12 108311737 missense probably damaging 1.00
R1878:Hhipl1 UTSW 12 108320060 missense possibly damaging 0.93
R2001:Hhipl1 UTSW 12 108321859 missense possibly damaging 0.90
R2103:Hhipl1 UTSW 12 108327718 missense probably benign 0.04
R2132:Hhipl1 UTSW 12 108311690 missense probably damaging 1.00
R2342:Hhipl1 UTSW 12 108318462 missense probably damaging 1.00
R2408:Hhipl1 UTSW 12 108318547 missense probably benign 0.05
R3431:Hhipl1 UTSW 12 108311689 missense probably damaging 1.00
R3432:Hhipl1 UTSW 12 108311689 missense probably damaging 1.00
R3741:Hhipl1 UTSW 12 108318717 missense probably damaging 1.00
R3802:Hhipl1 UTSW 12 108312307 missense probably benign
R4744:Hhipl1 UTSW 12 108319979 missense possibly damaging 0.95
R4760:Hhipl1 UTSW 12 108320077 missense probably damaging 0.99
R4927:Hhipl1 UTSW 12 108311944 missense probably damaging 1.00
R5206:Hhipl1 UTSW 12 108312178 missense probably damaging 1.00
R5244:Hhipl1 UTSW 12 108312134 missense probably damaging 0.99
R5292:Hhipl1 UTSW 12 108327778 missense probably benign
R5445:Hhipl1 UTSW 12 108328208 missense probably damaging 0.97
R6248:Hhipl1 UTSW 12 108318705 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGGGACCTCCAATTCAGATCTCAC -3'
(R):5'- CACCGATCATTCCAAAGGGAGACG -3'

Sequencing Primer
(F):5'- GTGTCCCTTCAAGCAACATTTTAGG -3'
(R):5'- CCAAAGGGAGACGGGGAC -3'
Posted On2013-07-11