Incidental Mutation 'R7034:Erich1'
ID 546533
Institutional Source Beutler Lab
Gene Symbol Erich1
Ensembl Gene ENSMUSG00000051978
Gene Name glutamate rich 1
Synonyms
MMRRC Submission 045135-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.084) question?
Stock # R7034 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 14077561-14140301 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 14114330 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 60 (I60T)
Ref Sequence ENSEMBL: ENSMUSP00000147614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110813] [ENSMUST00000211242]
AlphaFold E9PY43
Predicted Effect probably benign
Transcript: ENSMUST00000110813
AA Change: I60T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000106436
Gene: ENSMUSG00000051978
AA Change: I60T

DomainStartEndE-ValueType
low complexity region 110 121 N/A INTRINSIC
low complexity region 155 171 N/A INTRINSIC
low complexity region 188 209 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000211242
AA Change: I60T

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,445,118 (GRCm39) probably null Het
Adamts1 T A 16: 85,599,634 (GRCm39) probably benign Het
Aff4 A G 11: 53,299,236 (GRCm39) K979E probably damaging Het
Aftph A T 11: 20,642,498 (GRCm39) M845K probably damaging Het
Akt2 T C 7: 27,336,437 (GRCm39) probably null Het
Aldh1a7 A T 19: 20,685,542 (GRCm39) L336Q possibly damaging Het
Ank3 C T 10: 69,835,209 (GRCm39) T680M probably damaging Het
Apeh T C 9: 107,971,470 (GRCm39) E59G possibly damaging Het
Armc8 C T 9: 99,366,018 (GRCm39) probably null Het
Armh3 A G 19: 45,953,688 (GRCm39) I195T probably damaging Het
Atp2b1 C T 10: 98,823,172 (GRCm39) T244I probably damaging Het
Btaf1 C A 19: 36,981,869 (GRCm39) T1633K probably benign Het
Cacng8 A G 7: 3,463,819 (GRCm39) S324G probably benign Het
Calcr T A 6: 3,692,543 (GRCm39) Q400L probably damaging Het
Caprin2 G A 6: 148,749,703 (GRCm39) P536S possibly damaging Het
Ccdc54 A T 16: 50,410,951 (GRCm39) M105K probably benign Het
Ccna1 T C 3: 54,953,460 (GRCm39) E381G possibly damaging Het
Cd2ap A T 17: 43,109,490 (GRCm39) L623Q probably damaging Het
Cdkl3 A G 11: 51,918,042 (GRCm39) E415G probably benign Het
Chd5 C A 4: 152,445,398 (GRCm39) L430I possibly damaging Het
Clspn G A 4: 126,474,775 (GRCm39) E975K possibly damaging Het
Cobl C A 11: 12,204,177 (GRCm39) V835F probably damaging Het
D430041D05Rik C A 2: 104,022,883 (GRCm39) R1037L probably damaging Het
Derl1 A G 15: 57,742,443 (GRCm39) probably null Het
Dhrs9 T G 2: 69,223,520 (GRCm39) N89K probably benign Het
Fam184a A T 10: 53,570,910 (GRCm39) S408T possibly damaging Het
Fcgr4 T A 1: 170,847,657 (GRCm39) M85K probably benign Het
Foxj3 A G 4: 119,476,497 (GRCm39) E259G probably damaging Het
Galnt11 T C 5: 25,463,811 (GRCm39) I361T probably damaging Het
Gck A G 11: 5,851,747 (GRCm39) S441P probably damaging Het
Gdap1l1 G T 2: 163,288,065 (GRCm39) V98F probably damaging Het
Gramd1a A G 7: 30,832,181 (GRCm39) probably null Het
H2ac21 C T 3: 96,127,304 (GRCm39) Q25* probably null Het
Herc3 A T 6: 58,853,840 (GRCm39) M629L probably benign Het
Hoxc12 G A 15: 102,846,795 (GRCm39) G229D probably damaging Het
Hycc2 T A 1: 58,574,696 (GRCm39) M282L probably benign Het
Itga9 T C 9: 118,527,433 (GRCm39) L528P probably benign Het
Krt39 A C 11: 99,412,062 (GRCm39) V8G probably benign Het
Krt71 A G 15: 101,646,772 (GRCm39) I312T probably benign Het
Lrrc37 T A 11: 103,506,638 (GRCm39) probably benign Het
Mllt11 A G 3: 95,127,744 (GRCm39) Y9H probably damaging Het
Mrgpra3 G T 7: 47,239,838 (GRCm39) N29K possibly damaging Het
Mug1 A G 6: 121,850,603 (GRCm39) T700A probably benign Het
Myl1 T C 1: 66,969,395 (GRCm39) N79S probably damaging Het
Myo18b G A 5: 112,871,770 (GRCm39) Q2104* probably null Het
Nalf1 G A 8: 9,820,589 (GRCm39) P144S possibly damaging Het
Ndufs2 T C 1: 171,065,877 (GRCm39) D256G probably benign Het
Nek5 T C 8: 22,597,739 (GRCm39) N280S probably benign Het
Nwd2 A T 5: 63,962,258 (GRCm39) N614I probably damaging Het
Or6c88 G A 10: 129,406,941 (GRCm39) C139Y possibly damaging Het
Parp1 G T 1: 180,425,817 (GRCm39) K849N possibly damaging Het
Pcnx2 T C 8: 126,512,041 (GRCm39) T1422A probably damaging Het
Plce1 A G 19: 38,727,801 (GRCm39) N1520S probably damaging Het
Ppcdc T C 9: 57,322,453 (GRCm39) T149A probably damaging Het
Ppl A G 16: 4,905,366 (GRCm39) V1643A probably benign Het
Pramel23 A T 4: 143,423,898 (GRCm39) I297N probably damaging Het
Prrx1 T A 1: 163,075,907 (GRCm39) M220L probably benign Het
Pspc1 A C 14: 56,996,085 (GRCm39) probably null Het
Ptpn20 A G 14: 33,336,392 (GRCm39) *44W probably null Het
Qars1 T A 9: 108,391,976 (GRCm39) V83E probably damaging Het
Rbm33 T C 5: 28,599,496 (GRCm39) M956T unknown Het
Sash1 C A 10: 8,605,847 (GRCm39) E848* probably null Het
Scai T A 2: 39,011,147 (GRCm39) Y163F probably damaging Het
Serpinf2 A T 11: 75,329,244 (GRCm39) probably benign Het
Sgo2b T A 8: 64,379,868 (GRCm39) H988L probably benign Het
Sh2b2 G A 5: 136,247,739 (GRCm39) T604I probably benign Het
Skint4 A T 4: 112,015,281 (GRCm39) I449F possibly damaging Het
Slc30a2 A G 4: 134,074,653 (GRCm39) I88V possibly damaging Het
Smug1 A G 15: 103,064,369 (GRCm39) L184P probably damaging Het
Spatc1 A G 15: 76,168,080 (GRCm39) T180A probably benign Het
Ssr1 A T 13: 38,178,001 (GRCm39) L20Q probably null Het
Supt4a A G 11: 87,634,084 (GRCm39) E100G probably damaging Het
Teddm2 T C 1: 153,726,320 (GRCm39) I132V probably benign Het
Tmem131 C T 1: 36,832,054 (GRCm39) G1861E possibly damaging Het
Tpr A T 1: 150,299,358 (GRCm39) H1186L probably benign Het
Trim34b A T 7: 103,978,743 (GRCm39) probably benign Het
Trpm2 T C 10: 77,748,426 (GRCm39) M1415V probably benign Het
Ttll12 A G 15: 83,471,086 (GRCm39) F264S probably benign Het
Vmn2r59 T C 7: 41,695,644 (GRCm39) E256G probably benign Het
Vmn2r93 A T 17: 18,546,672 (GRCm39) H848L probably benign Het
Vps35l T C 7: 118,372,315 (GRCm39) S290P probably damaging Het
Wdfy3 G A 5: 102,055,384 (GRCm39) T1562I probably damaging Het
Ybey T C 10: 76,304,197 (GRCm39) S2G possibly damaging Het
Zfp346 A T 13: 55,280,200 (GRCm39) Q308L probably benign Het
Other mutations in Erich1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Erich1 APN 8 14,083,770 (GRCm39) splice site probably benign
IGL00927:Erich1 APN 8 14,083,518 (GRCm39) missense probably damaging 1.00
IGL01448:Erich1 APN 8 14,128,853 (GRCm39) missense possibly damaging 0.95
R1165:Erich1 UTSW 8 14,140,530 (GRCm39) unclassified probably benign
R1541:Erich1 UTSW 8 14,080,688 (GRCm39) missense probably damaging 0.97
R1699:Erich1 UTSW 8 14,140,259 (GRCm39) missense possibly damaging 0.73
R2094:Erich1 UTSW 8 14,140,527 (GRCm39) unclassified probably benign
R2153:Erich1 UTSW 8 14,128,773 (GRCm39) missense probably benign 0.08
R3807:Erich1 UTSW 8 14,083,695 (GRCm39) missense probably benign 0.11
R5787:Erich1 UTSW 8 14,083,776 (GRCm39) splice site probably null
R6119:Erich1 UTSW 8 14,083,692 (GRCm39) missense probably benign
R7363:Erich1 UTSW 8 14,083,688 (GRCm39) missense probably benign 0.05
R7687:Erich1 UTSW 8 14,080,691 (GRCm39) missense probably damaging 0.99
R9087:Erich1 UTSW 8 14,083,623 (GRCm39) missense probably damaging 0.99
R9376:Erich1 UTSW 8 14,080,719 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACAGTACCATGCTTACTCATACCC -3'
(R):5'- TGCTCTCCTGACAAAATACTTTGC -3'

Sequencing Primer
(F):5'- TGGTGCAATACAGAAAATCATGATG -3'
(R):5'- CTCCTGACAAAATACTTTGCTTTTTG -3'
Posted On 2019-05-13