Incidental Mutation 'R7034:Ppl'
ID546569
Institutional Source Beutler Lab
Gene Symbol Ppl
Ensembl Gene ENSMUSG00000039457
Gene Nameperiplakin
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_008909

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7034 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location5086291-5132421 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5087502 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1643 (V1643A)
Ref Sequence ENSEMBL: ENSMUSP00000039360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035672] [ENSMUST00000052449] [ENSMUST00000229126] [ENSMUST00000230703]
Predicted Effect probably benign
Transcript: ENSMUST00000035672
AA Change: V1643A

PolyPhen 2 Score 0.289 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000039360
Gene: ENSMUSG00000039457
AA Change: V1643A

DomainStartEndE-ValueType
SPEC 123 211 1.58e0 SMART
SPEC 214 315 3.38e-2 SMART
SPEC 321 483 1.11e-2 SMART
SPEC 503 610 4.96e0 SMART
Blast:SPEC 613 717 5e-59 BLAST
low complexity region 718 729 N/A INTRINSIC
Blast:SPEC 732 859 2e-60 BLAST
low complexity region 893 908 N/A INTRINSIC
low complexity region 963 982 N/A INTRINSIC
internal_repeat_2 984 1004 3.46e-5 PROSPERO
internal_repeat_1 992 1008 8.09e-7 PROSPERO
low complexity region 1011 1020 N/A INTRINSIC
low complexity region 1027 1042 N/A INTRINSIC
internal_repeat_1 1112 1128 8.09e-7 PROSPERO
coiled coil region 1180 1279 N/A INTRINSIC
low complexity region 1346 1355 N/A INTRINSIC
low complexity region 1386 1433 N/A INTRINSIC
low complexity region 1455 1479 N/A INTRINSIC
Blast:SPEC 1529 1610 8e-30 BLAST
low complexity region 1612 1630 N/A INTRINSIC
PLEC 1649 1683 1.34e-5 SMART
PLEC 1698 1733 2.23e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000052449
SMART Domains Protein: ENSMUSP00000061843
Gene: ENSMUSG00000039473

DomainStartEndE-ValueType
Pfam:HUN 117 168 1.4e-22 PFAM
low complexity region 181 224 N/A INTRINSIC
low complexity region 232 238 N/A INTRINSIC
low complexity region 250 267 N/A INTRINSIC
low complexity region 331 344 N/A INTRINSIC
Pfam:UBN_AB 353 573 2.4e-80 PFAM
low complexity region 792 804 N/A INTRINSIC
low complexity region 856 882 N/A INTRINSIC
low complexity region 905 934 N/A INTRINSIC
low complexity region 970 984 N/A INTRINSIC
low complexity region 996 1006 N/A INTRINSIC
low complexity region 1016 1034 N/A INTRINSIC
low complexity region 1084 1098 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229126
Predicted Effect probably benign
Transcript: ENSMUST00000230703
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of desmosomes and of the epidermal cornified envelope in keratinocytes. The N-terminal domain of this protein interacts with the plasma membrane and its C-terminus interacts with intermediate filaments. Through its rod domain, this protein forms complexes with envoplakin. This protein may serve as a link between the cornified envelope and desmosomes as well as intermediate filaments. AKT1/PKB, a protein kinase mediating a variety of cell growth and survival signaling processes, is reported to interact with this protein, suggesting a possible role for this protein as a localization signal in AKT1-mediated signaling. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are fertile and grossly normal with no apparent skin abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017N19Rik T A 10: 100,609,256 probably null Het
9030624J02Rik T C 7: 118,773,092 S290P probably damaging Het
9130011E15Rik A G 19: 45,965,249 I195T probably damaging Het
Adamts1 T A 16: 85,802,746 probably benign Het
Aff4 A G 11: 53,408,409 K979E probably damaging Het
Aftph A T 11: 20,692,498 M845K probably damaging Het
Akt2 T C 7: 27,637,012 probably null Het
Aldh1a7 A T 19: 20,708,178 L336Q possibly damaging Het
Ank3 C T 10: 69,999,379 T680M probably damaging Het
Apeh T C 9: 108,094,271 E59G possibly damaging Het
Armc8 C T 9: 99,483,965 probably null Het
Atp2b1 C T 10: 98,987,310 T244I probably damaging Het
Btaf1 C A 19: 37,004,469 T1633K probably benign Het
Cacng8 A G 7: 3,415,303 S324G probably benign Het
Calcr T A 6: 3,692,543 Q400L probably damaging Het
Caprin2 G A 6: 148,848,205 P536S possibly damaging Het
Ccdc54 A T 16: 50,590,588 M105K probably benign Het
Ccna1 T C 3: 55,046,039 E381G possibly damaging Het
Cd2ap A T 17: 42,798,599 L623Q probably damaging Het
Cdkl3 A G 11: 52,027,215 E415G probably benign Het
Chd5 C A 4: 152,360,941 L430I possibly damaging Het
Clspn G A 4: 126,580,982 E975K possibly damaging Het
Cobl C A 11: 12,254,177 V835F probably damaging Het
D430041D05Rik C A 2: 104,192,538 R1037L probably damaging Het
Derl1 A G 15: 57,879,047 probably null Het
Dhrs9 T G 2: 69,393,176 N89K probably benign Het
Erich1 A G 8: 14,064,330 I60T probably benign Het
Fam126b T A 1: 58,535,537 M282L probably benign Het
Fam155a G A 8: 9,770,589 P144S possibly damaging Het
Fam184a A T 10: 53,694,814 S408T possibly damaging Het
Fcgr4 T A 1: 171,020,088 M85K probably benign Het
Foxj3 A G 4: 119,619,300 E259G probably damaging Het
Galnt11 T C 5: 25,258,813 I361T probably damaging Het
Gck A G 11: 5,901,747 S441P probably damaging Het
Gdap1l1 G T 2: 163,446,145 V98F probably damaging Het
Gm13089 A T 4: 143,697,328 I297N probably damaging Het
Gm884 T A 11: 103,615,812 probably benign Het
Gramd1a A G 7: 31,132,756 probably null Het
Herc3 A T 6: 58,876,855 M629L probably benign Het
Hist2h2ab C T 3: 96,219,988 Q25* probably null Het
Hoxc12 G A 15: 102,938,360 G229D probably damaging Het
Itga9 T C 9: 118,698,365 L528P probably benign Het
Krt39 A C 11: 99,521,236 V8G probably benign Het
Krt71 A G 15: 101,738,337 I312T probably benign Het
Mllt11 A G 3: 95,220,433 Y9H probably damaging Het
Mrgpra3 G T 7: 47,590,090 N29K possibly damaging Het
Mug1 A G 6: 121,873,644 T700A probably benign Het
Myl1 T C 1: 66,930,236 N79S probably damaging Het
Myo18b G A 5: 112,723,904 Q2104* probably null Het
Ndufs2 T C 1: 171,238,308 D256G probably benign Het
Nek5 T C 8: 22,107,723 N280S probably benign Het
Nwd2 A T 5: 63,804,915 N614I probably damaging Het
Olfr794 G A 10: 129,571,072 C139Y possibly damaging Het
Parp1 G T 1: 180,598,252 K849N possibly damaging Het
Pcnx2 T C 8: 125,785,302 T1422A probably damaging Het
Plce1 A G 19: 38,739,357 N1520S probably damaging Het
Ppcdc T C 9: 57,415,170 T149A probably damaging Het
Prrx1 T A 1: 163,248,338 M220L probably benign Het
Pspc1 A C 14: 56,758,628 probably null Het
Ptpn20 A G 14: 33,614,435 *44W probably null Het
Qars T A 9: 108,514,777 V83E probably damaging Het
Rbm33 T C 5: 28,394,498 M956T unknown Het
Sash1 C A 10: 8,730,083 E848* probably null Het
Scai T A 2: 39,121,135 Y163F probably damaging Het
Serpinf2 A T 11: 75,438,418 probably benign Het
Sgo2b T A 8: 63,926,834 H988L probably benign Het
Sh2b2 G A 5: 136,218,885 T604I probably benign Het
Skint4 A T 4: 112,158,084 I449F possibly damaging Het
Slc30a2 A G 4: 134,347,342 I88V possibly damaging Het
Smug1 A G 15: 103,155,942 L184P probably damaging Het
Spatc1 A G 15: 76,283,880 T180A probably benign Het
Ssr1 A T 13: 37,994,025 L20Q probably null Het
Supt4a A G 11: 87,743,258 E100G probably damaging Het
Teddm2 T C 1: 153,850,574 I132V probably benign Het
Tmem131 C T 1: 36,792,973 G1861E possibly damaging Het
Tpr A T 1: 150,423,607 H1186L probably benign Het
Trim34b A T 7: 104,329,536 probably benign Het
Trpm2 T C 10: 77,912,592 M1415V probably benign Het
Ttll12 A G 15: 83,586,885 F264S probably benign Het
Vmn2r59 T C 7: 42,046,220 E256G probably benign Het
Vmn2r93 A T 17: 18,326,410 H848L probably benign Het
Wdfy3 G A 5: 101,907,518 T1562I probably damaging Het
Ybey T C 10: 76,468,363 S2G possibly damaging Het
Zfp346 A T 13: 55,132,387 Q308L probably benign Het
Other mutations in Ppl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Ppl APN 16 5089545 missense probably benign 0.41
IGL00484:Ppl APN 16 5087952 missense probably benign 0.13
IGL00654:Ppl APN 16 5087308 missense possibly damaging 0.94
IGL00832:Ppl APN 16 5088975 missense probably damaging 1.00
IGL01104:Ppl APN 16 5094491 missense probably benign 0.01
IGL01327:Ppl APN 16 5087644 missense probably benign 0.19
IGL01644:Ppl APN 16 5091855 missense probably damaging 1.00
IGL01824:Ppl APN 16 5087889 missense probably damaging 1.00
IGL02071:Ppl APN 16 5113072 missense probably benign 0.04
IGL02085:Ppl APN 16 5089816 missense probably benign 0.09
IGL02282:Ppl APN 16 5101458 missense probably damaging 1.00
IGL02635:Ppl APN 16 5089767 missense probably benign 0.01
IGL02649:Ppl APN 16 5087463 missense probably damaging 1.00
IGL02888:Ppl APN 16 5100407 missense possibly damaging 0.89
IGL03305:Ppl APN 16 5093233 missense possibly damaging 0.62
G4846:Ppl UTSW 16 5087206 missense probably damaging 1.00
IGL03097:Ppl UTSW 16 5096726 missense probably damaging 0.98
R0759:Ppl UTSW 16 5089777 missense probably benign 0.00
R0786:Ppl UTSW 16 5089054 missense probably damaging 1.00
R1024:Ppl UTSW 16 5100000 missense probably damaging 1.00
R1498:Ppl UTSW 16 5104765 missense probably benign 0.05
R1544:Ppl UTSW 16 5102597 nonsense probably null
R1597:Ppl UTSW 16 5107574 missense probably benign 0.20
R1863:Ppl UTSW 16 5087980 missense possibly damaging 0.69
R1921:Ppl UTSW 16 5106124 missense possibly damaging 0.80
R2230:Ppl UTSW 16 5088981 missense possibly damaging 0.51
R2275:Ppl UTSW 16 5094552 missense probably benign 0.00
R2355:Ppl UTSW 16 5094497 missense probably benign 0.00
R3410:Ppl UTSW 16 5107517 missense possibly damaging 0.81
R3737:Ppl UTSW 16 5106857 missense probably benign
R3797:Ppl UTSW 16 5104550 splice site probably benign
R3968:Ppl UTSW 16 5100332 splice site probably null
R3970:Ppl UTSW 16 5100332 splice site probably null
R4034:Ppl UTSW 16 5106857 missense probably benign
R4583:Ppl UTSW 16 5104536 missense probably benign 0.02
R4639:Ppl UTSW 16 5089446 missense probably damaging 1.00
R4762:Ppl UTSW 16 5088982 missense probably benign 0.00
R4828:Ppl UTSW 16 5104926 missense probably damaging 1.00
R4869:Ppl UTSW 16 5104889 missense probably damaging 0.99
R4925:Ppl UTSW 16 5104982 missense probably damaging 1.00
R4983:Ppl UTSW 16 5088718 missense possibly damaging 0.75
R4984:Ppl UTSW 16 5087641 missense probably benign
R4997:Ppl UTSW 16 5089371 missense probably damaging 1.00
R5072:Ppl UTSW 16 5088878 missense probably benign 0.01
R5073:Ppl UTSW 16 5088878 missense probably benign 0.01
R5074:Ppl UTSW 16 5088878 missense probably benign 0.01
R5286:Ppl UTSW 16 5089123 nonsense probably null
R5398:Ppl UTSW 16 5104922 missense probably benign 0.00
R5448:Ppl UTSW 16 5107566 missense probably benign
R5664:Ppl UTSW 16 5106055 missense probably benign 0.00
R5873:Ppl UTSW 16 5106049 critical splice donor site probably null
R5918:Ppl UTSW 16 5104901 missense probably benign 0.00
R5951:Ppl UTSW 16 5088628 missense probably benign 0.25
R6038:Ppl UTSW 16 5102581 missense possibly damaging 0.94
R6038:Ppl UTSW 16 5102581 missense possibly damaging 0.94
R6088:Ppl UTSW 16 5104988 missense possibly damaging 0.73
R6149:Ppl UTSW 16 5107596 nonsense probably null
R6358:Ppl UTSW 16 5087929 nonsense probably null
R6379:Ppl UTSW 16 5097691 missense probably benign 0.02
R6468:Ppl UTSW 16 5092441 missense probably damaging 1.00
R6514:Ppl UTSW 16 5087317 missense probably damaging 1.00
R6528:Ppl UTSW 16 5087616 missense probably benign 0.00
R6703:Ppl UTSW 16 5089464 missense probably damaging 0.99
R6721:Ppl UTSW 16 5107469 missense probably damaging 0.97
R6811:Ppl UTSW 16 5089144 missense probably damaging 0.99
R6934:Ppl UTSW 16 5094509 missense probably benign 0.00
R7076:Ppl UTSW 16 5100119 missense probably damaging 1.00
R7300:Ppl UTSW 16 5102371 missense possibly damaging 0.87
R7349:Ppl UTSW 16 5104729 missense probably damaging 0.99
R7359:Ppl UTSW 16 5089341 missense possibly damaging 0.78
R7378:Ppl UTSW 16 5112996 missense possibly damaging 0.91
R7383:Ppl UTSW 16 5097971 missense probably damaging 1.00
R7389:Ppl UTSW 16 5106713 splice site probably null
R7445:Ppl UTSW 16 5089068 missense probably damaging 1.00
R7687:Ppl UTSW 16 5097942 missense probably benign 0.00
R7752:Ppl UTSW 16 5102302 missense probably benign 0.09
R7827:Ppl UTSW 16 5087964 missense probably damaging 1.00
R7836:Ppl UTSW 16 5088861 missense probably damaging 1.00
R7842:Ppl UTSW 16 5088861 missense probably damaging 1.00
R7896:Ppl UTSW 16 5088861 missense probably damaging 1.00
R7898:Ppl UTSW 16 5088861 missense probably damaging 1.00
R7943:Ppl UTSW 16 5088861 missense probably damaging 1.00
R8122:Ppl UTSW 16 5088861 missense probably damaging 1.00
R8126:Ppl UTSW 16 5088861 missense probably damaging 1.00
R8284:Ppl UTSW 16 5132337 missense probably damaging 1.00
RF009:Ppl UTSW 16 5097931 missense probably benign 0.00
X0054:Ppl UTSW 16 5104902 missense probably benign 0.00
Z1088:Ppl UTSW 16 5089507 missense probably damaging 0.97
Z1176:Ppl UTSW 16 5106778 missense probably damaging 0.99
Z1177:Ppl UTSW 16 5097957 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGGAGAACTTCTTGCCTGAC -3'
(R):5'- TGGCAGCAACAGAAACTCG -3'

Sequencing Primer
(F):5'- ATTACTGATGACTCCCCATTAGGAC -3'
(R):5'- GCAACAGAAACTCGAGATCTG -3'
Posted On2019-05-13