Incidental Mutation 'R7094:Bub1'
ID550339
Institutional Source Beutler Lab
Gene Symbol Bub1
Ensembl Gene ENSMUSG00000027379
Gene NameBUB1, mitotic checkpoint serine/threonine kinase
SynonymsD2Xrf87, Bub1a
MMRRC Submission
Accession Numbers

Genbank: NM_009772; MGI: 1100510

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7094 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location127801122-127831865 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 127821761 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 240 (E240V)
Ref Sequence ENSEMBL: ENSMUSP00000028858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028858]
Predicted Effect probably null
Transcript: ENSMUST00000028858
AA Change: E240V

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000028858
Gene: ENSMUSG00000027379
AA Change: E240V

DomainStartEndE-ValueType
Mad3_BUB1_I 4 126 7.41e-46 SMART
low complexity region 216 225 N/A INTRINSIC
low complexity region 372 385 N/A INTRINSIC
Pfam:Pkinase_Tyr 762 1011 9.3e-10 PFAM
Pfam:Pkinase 762 1037 1.7e-21 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine-protein kinase that play a central role in mitosis. The encoded protein functions in part by phosphorylating members of the mitotic checkpoint complex and activating the spindle checkpoint. This protein also plays a role in inhibiting the activation of the anaphase promoting complex/cyclosome. This protein may also function in the DNA damage response. Mutations in this gene have been associated with aneuploidy and several forms of cancer. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a null mutation exhibit embryonic lethality prior to implantation. Mice homozygous for a kinase dead allele exhibit aneuploidy in somatic and germ cells and reduced male fertility. [provided by MGI curators]
Allele List at MGI

All alleles(22) : Targeted, knock-out(3) Targeted, other(4) Gene trapped(15)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,298,610 I2786F probably damaging Het
Actl6a A T 3: 32,706,338 probably benign Het
Actn2 A G 13: 12,309,657 V100A probably damaging Het
Arfgef3 G T 10: 18,646,439 A613E probably damaging Het
Atf6b G A 17: 34,653,816 probably null Het
BC048403 A G 10: 121,740,193 Y73C possibly damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C530008M17Rik C T 5: 76,859,032 P1080L unknown Het
Ccdc141 C A 2: 77,041,453 R829L possibly damaging Het
Ccdc85c GCCGCCGCCGCCAGCGCCCCCCGCCGCCGCCAGCGCC GCCGCCGCCGCCAGCGCC 12: 108,274,618 probably null Het
Cd209g T C 8: 4,136,790 F112L possibly damaging Het
Cebpe C T 14: 54,710,603 R261H probably damaging Het
Cfap100 T C 6: 90,413,454 E68G Het
Chd9 A G 8: 90,989,561 N921S unknown Het
Chil6 T C 3: 106,404,170 N98S probably damaging Het
Clip1 T C 5: 123,623,270 K734E probably benign Het
Cyp11b2 A G 15: 74,853,658 F204S possibly damaging Het
Dnah5 A G 15: 28,453,336 T4418A probably damaging Het
Dysf T C 6: 84,100,202 V649A probably benign Het
Ergic3 G A 2: 156,016,763 V270M possibly damaging Het
Eva1a C T 6: 82,092,043 T117I probably damaging Het
Fat4 G A 3: 38,889,874 G972D probably damaging Het
Gm14412 A T 2: 177,317,345 N39K probably damaging Het
Gm5565 T C 5: 146,158,274 T221A probably benign Het
Gnptab T G 10: 88,379,504 V29G possibly damaging Het
Grem2 T C 1: 174,836,989 Y98C probably damaging Het
Grik2 A T 10: 49,355,916 I506N possibly damaging Het
Has2 T A 15: 56,681,621 Y195F probably damaging Het
Lars2 T C 9: 123,459,585 L832P probably damaging Het
Lipo5 T A 19: 33,468,849 E49D probably damaging Het
Macc1 T A 12: 119,450,391 Y767* probably null Het
Map2 G T 1: 66,412,727 E259* probably null Het
Mcm9 T C 10: 53,620,157 D310G probably damaging Het
Mink1 C A 11: 70,610,075 probably null Het
Mtrr T C 13: 68,579,684 T48A possibly damaging Het
Nrsn1 A T 13: 25,253,741 I68N possibly damaging Het
Olfr1083-ps T C 2: 86,607,328 N81S unknown Het
Olfr1243 A T 2: 89,527,558 I284K probably damaging Het
Olfr374 A T 8: 72,109,503 probably benign Het
Olfr484 G T 7: 108,124,633 T210N probably benign Het
Olfr560 A G 7: 102,753,098 M277T probably benign Het
Pcdh17 A G 14: 84,447,395 D434G probably damaging Het
Rnf213 T A 11: 119,437,604 probably null Het
Selplg GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT GTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCTGCCTCCATGGGTGCTGGCTGCGAGGTCTCT 5: 113,819,695 probably benign Het
Sez6l2 A G 7: 126,952,924 E121G probably damaging Het
Slc35e4 T C 11: 3,913,118 S24G probably benign Het
Slc39a2 G T 14: 51,893,689 probably benign Het
Slitrk5 C T 14: 111,680,836 P631S probably benign Het
Taf2 A G 15: 55,060,086 V265A probably benign Het
Tas2r106 T C 6: 131,678,579 N103S probably benign Het
Tgm1 T C 14: 55,704,843 T684A possibly damaging Het
Tgm7 C T 2: 121,099,008 G262S probably damaging Het
Tpp2 T A 1: 43,968,988 S451T probably damaging Het
Trim15 T C 17: 36,862,896 Y240C probably benign Het
Trio A T 15: 27,891,448 C465S unknown Het
Ttc22 G A 4: 106,635,907 W250* probably null Het
Upb1 C A 10: 75,438,208 F356L probably damaging Het
Vmn2r99 T A 17: 19,379,311 M419K probably benign Het
Vstm2a G A 11: 16,257,990 probably benign Het
Zfp820 T C 17: 21,819,265 T361A probably benign Het
Other mutations in Bub1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00765:Bub1 APN 2 127829472 missense probably damaging 0.96
IGL00795:Bub1 APN 2 127821815 missense probably benign 0.00
IGL00966:Bub1 APN 2 127810663 missense probably damaging 1.00
IGL01807:Bub1 APN 2 127812977 missense probably benign 0.00
IGL02212:Bub1 APN 2 127805351 missense probably damaging 1.00
IGL02537:Bub1 APN 2 127801347 nonsense probably null
IGL02935:Bub1 APN 2 127801295 missense probably damaging 1.00
IGL03064:Bub1 APN 2 127817453 missense probably benign 0.00
R0052:Bub1 UTSW 2 127809039 missense probably benign 0.10
R0052:Bub1 UTSW 2 127809039 missense probably benign 0.10
R0325:Bub1 UTSW 2 127801394 nonsense probably null
R1502:Bub1 UTSW 2 127827419 missense probably damaging 0.98
R1627:Bub1 UTSW 2 127809013 missense probably benign 0.01
R1743:Bub1 UTSW 2 127813850 missense probably damaging 1.00
R1778:Bub1 UTSW 2 127803122 missense possibly damaging 0.60
R2043:Bub1 UTSW 2 127804220 missense probably damaging 1.00
R2108:Bub1 UTSW 2 127819335 missense probably damaging 0.99
R2165:Bub1 UTSW 2 127801281 missense probably benign 0.01
R2190:Bub1 UTSW 2 127810725 missense probably benign 0.06
R2507:Bub1 UTSW 2 127801423 missense probably benign 0.04
R2508:Bub1 UTSW 2 127801423 missense probably benign 0.04
R3836:Bub1 UTSW 2 127814886 missense probably damaging 1.00
R3862:Bub1 UTSW 2 127814756 splice site probably benign
R3904:Bub1 UTSW 2 127821942 missense probably benign 0.08
R4373:Bub1 UTSW 2 127805236 intron probably benign
R4580:Bub1 UTSW 2 127829676 critical splice donor site probably null
R4751:Bub1 UTSW 2 127823938 intron probably benign
R5239:Bub1 UTSW 2 127821696 missense probably damaging 1.00
R5498:Bub1 UTSW 2 127814709 missense possibly damaging 0.59
R5591:Bub1 UTSW 2 127819343 missense probably benign 0.16
R5672:Bub1 UTSW 2 127804880 missense possibly damaging 0.70
R5907:Bub1 UTSW 2 127819222 missense probably benign 0.02
R6714:Bub1 UTSW 2 127814732 missense probably benign 0.08
R6781:Bub1 UTSW 2 127807857 missense probably damaging 0.99
R6931:Bub1 UTSW 2 127801382 missense probably damaging 1.00
R7057:Bub1 UTSW 2 127829527 missense probably benign
R8197:Bub1 UTSW 2 127801257 missense probably damaging 1.00
Z1176:Bub1 UTSW 2 127829565 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATGGAATGAGCTCAAGGCATC -3'
(R):5'- TGGCATCTTCCACTTGTGATG -3'

Sequencing Primer
(F):5'- GAGCTCAAGGCATCTCAAGTTTC -3'
(R):5'- GGCATCTTCCACTTGTGATGAAAAG -3'
Posted On2019-05-15