Incidental Mutation 'PIT4354001:Hfe2'
ID554809
Institutional Source Beutler Lab
Gene Symbol Hfe2
Ensembl Gene ENSMUSG00000038403
Gene Namehemochromatosis type 2 (juvenile)
Synonyms5230400G09Rik, DL-M, Rgmc, hemojuvelin, HJV, 2310035L15Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4354001 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location96525172-96529210 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 96528445 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 340 (C340R)
Ref Sequence ENSEMBL: ENSMUSP00000046659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049208]
Predicted Effect probably damaging
Transcript: ENSMUST00000049208
AA Change: C340R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046659
Gene: ENSMUSG00000038403
AA Change: C340R

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:RGM_N 34 219 6.2e-61 PFAM
Pfam:RGM_C 223 389 4.7e-59 PFAM
transmembrane domain 397 419 N/A INTRINSIC
Coding Region Coverage
  • 1x: 92.5%
  • 3x: 90.1%
  • 10x: 83.2%
  • 20x: 69.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is involved in iron metabolism. It may be a component of the signaling pathway which activates hepcidin or it may act as a modulator of hepcidin expression. It could also represent the cellular receptor for hepcidin. Two uORFs in the 5' UTR negatively regulate the expression and activity of the encoded protein. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. Defects in this gene are the cause of hemochromatosis type 2A, also called juvenile hemochromatosis (JH). JH is an early-onset autosomal recessive disorder due to severe iron overload resulting in hypogonadotrophic hypogonadism, hepatic fibrosis or cirrhosis and cardiomyopathy, occurring typically before age of 30. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit lack of hepcidin expression, severe iron overload and male sterility. Mice homozygous for a different knock-out allele display systemic iron overload, a severe deficit in hepcidin production, overexpression of ferroportin but normal male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap2 A T 5: 62,654,049 Y1140N probably damaging Het
Ccdc83 A T 7: 90,223,974 M391K probably benign Het
Cntnap1 A T 11: 101,181,297 I459F probably damaging Het
Cr2 T A 1: 195,166,309 Y302F probably damaging Het
Ctu2 A T 8: 122,478,975 D179V probably damaging Het
Cubn G A 2: 13,468,852 Q427* probably null Het
Depdc7 A G 2: 104,728,188 S163P probably benign Het
Eif2s3y C T Y: 1,020,126 R385C probably benign Het
Gigyf1 A G 5: 137,524,104 K728R unknown Het
Gm1587 G A 14: 77,797,033 R32* probably null Het
Gm17689 T A 9: 36,581,301 S103C possibly damaging Het
Isy1 A G 6: 87,833,671 I53T possibly damaging Het
Myh8 A T 11: 67,289,630 N564I probably benign Het
Neb A T 2: 52,245,318 I3260N probably damaging Het
Npc1 C T 18: 12,211,535 G426E probably benign Het
Nrd1 G A 4: 109,054,025 probably null Het
Olfr1221 C A 2: 89,112,486 E9* probably null Het
Olfr1257 T A 2: 89,881,508 S227R probably benign Het
Olfr56 G A 11: 49,134,305 V38M probably damaging Het
Prss51 T A 14: 64,097,097 V91D probably damaging Het
Qpct A C 17: 79,081,759 Y280S probably benign Het
Rbpms A G 8: 33,806,838 V137A possibly damaging Het
Rgl2 T A 17: 33,933,940 M441K possibly damaging Het
Sdhaf3 A T 6: 6,956,072 I16F possibly damaging Het
Slc38a3 T G 9: 107,657,649 N176H probably benign Het
Sos1 T C 17: 80,449,356 S256G possibly damaging Het
Spg11 A T 2: 122,088,185 C988S probably damaging Het
Sync A T 4: 129,306,654 Q451L possibly damaging Het
Tbc1d31 A G 15: 57,967,933 Y929C probably benign Het
Thbs2 G A 17: 14,689,968 T123I probably damaging Het
Thsd7a A C 6: 12,331,927 probably null Het
Tnfrsf11a T C 1: 105,821,517 L220P probably damaging Het
Trbv13-2 G A 6: 41,121,818 C109Y probably damaging Het
Ugt3a1 G A 15: 9,306,360 W198* probably null Het
Usp14 G A 18: 9,996,189 R464W probably damaging Het
Vmn1r2 C T 4: 3,172,162 S27L probably benign Het
Vmn1r68 T A 7: 10,528,031 N47Y probably benign Het
Zfc3h1 T A 10: 115,427,039 Y1719* probably null Het
Other mutations in Hfe2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01671:Hfe2 APN 3 96528491 missense probably damaging 1.00
IGL02342:Hfe2 APN 3 96528172 missense possibly damaging 0.78
IGL03083:Hfe2 APN 3 96528606 missense probably benign 0.41
PIT4504001:Hfe2 UTSW 3 96528497 missense probably damaging 1.00
R4602:Hfe2 UTSW 3 96527553 missense probably benign 0.02
R5475:Hfe2 UTSW 3 96527283 missense probably benign 0.19
R5761:Hfe2 UTSW 3 96528622 missense probably benign 0.00
R7044:Hfe2 UTSW 3 96527474 missense possibly damaging 0.58
R7117:Hfe2 UTSW 3 96528226 missense possibly damaging 0.95
R7206:Hfe2 UTSW 3 96528128 missense probably damaging 1.00
Z1177:Hfe2 UTSW 3 96527197 missense possibly damaging 0.88
Z1177:Hfe2 UTSW 3 96528087 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- ATCATTCGACAGACAGCTGGG -3'
(R):5'- GCTGGCCTACTTACTGAAGC -3'

Sequencing Primer
(F):5'- GCAGCTCTCCTTCTCCATCAGG -3'
(R):5'- TGGCCTACTTACTGAAGCAAAGC -3'
Posted On2019-06-07