Mutagenetix > Incidental Mutations

Incidental Mutation 'PIT4354001:Isy1'

List |< first << previous [record 13 of 39] next >> last >|

554818

Institutional Source

Beutler Lab

Gene Symbol

Isy1

Ensembl Gene

ENSMUSG00000030056

Gene Name

ISY1 splicing factor homolog

Synonyms

5830446M03Rik

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.226) question?

Stock #

PIT4354001 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

87814269-87838798 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 87833671 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 53 (I53T)

Ref Sequence

ENSEMBL: ENSMUSP00000086923 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089497] [ENSMUST00000204419] [ENSMUST00000204431] [ENSMUST00000204881] [ENSMUST00000205070]

PDB Structure

Solution structure of Isy1 domain in hypothetical protein [SOLUTION NMR]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000089497
AA Change: I53T

PolyPhen 2 Score 0.677 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000086923
Gene: ENSMUSG00000030056
AA Change: I53T

Domain	Start	End	E-Value	Type
Pfam:Isy1	1	266	5.1e-101	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000204419
AA Change: I45T

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000144743
Gene: ENSMUSG00000107928
AA Change: I45T

Domain	Start	End	E-Value	Type
Pfam:Isy1	1	218	1.8e-83	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000204431
AA Change: I67T

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000145001
Gene: ENSMUSG00000030056
AA Change: I67T

Domain	Start	End	E-Value	Type
Pfam:Isy1	1	57	2.4e-17	PFAM
Pfam:Isy1	50	95	2.7e-15	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000204881
AA Change: I53T

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000144710
Gene: ENSMUSG00000030056
AA Change: I53T

Domain	Start	End	E-Value	Type
Pfam:Isy1	1	124	6.8e-51	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000205070

SMART Domains

Protein: ENSMUSP00000144956
Gene: ENSMUSG00000030056

Domain	Start	End	E-Value	Type
Pfam:Isy1	1	50	8.1e-17	PFAM

Coding Region Coverage

1x: 92.5%
3x: 90.1%
10x: 83.2%
20x: 69.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus represents naturally occurring read-through transcription between the neighboring ISY1 (ISY1 splicing factor homolog) and RAB43 (RAB43, member RAS oncogene family) gene on chromosome 3. The read-through transcript encodes a protein that shares sequence identity with the upstream gene product, but its C-terminus is distinct due to a frameshift relative to the downstream gene. [provided by RefSeq, Mar 2011]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arap2	A	T	5: 62,654,049	Y1140N	probably damaging	Het
Ccdc83	A	T	7: 90,223,974	M391K	probably benign	Het
Cntnap1	A	T	11: 101,181,297	I459F	probably damaging	Het
Cr2	T	A	1: 195,166,309	Y302F	probably damaging	Het
Ctu2	A	T	8: 122,478,975	D179V	probably damaging	Het
Cubn	G	A	2: 13,468,852	Q427*	probably null	Het
Depdc7	A	G	2: 104,728,188	S163P	probably benign	Het
Eif2s3y	C	T	Y: 1,020,126	R385C	probably benign	Het
Gigyf1	A	G	5: 137,524,104	K728R	unknown	Het
Gm1587	G	A	14: 77,797,033	R32*	probably null	Het
Gm17689	T	A	9: 36,581,301	S103C	possibly damaging	Het
Hfe2	T	C	3: 96,528,445	C340R	probably damaging	Het
Myh8	A	T	11: 67,289,630	N564I	probably benign	Het
Neb	A	T	2: 52,245,318	I3260N	probably damaging	Het
Npc1	C	T	18: 12,211,535	G426E	probably benign	Het
Nrd1	G	A	4: 109,054,025		probably null	Het
Olfr1221	C	A	2: 89,112,486	E9*	probably null	Het
Olfr1257	T	A	2: 89,881,508	S227R	probably benign	Het
Olfr56	G	A	11: 49,134,305	V38M	probably damaging	Het
Prss51	T	A	14: 64,097,097	V91D	probably damaging	Het
Qpct	A	C	17: 79,081,759	Y280S	probably benign	Het
Rbpms	A	G	8: 33,806,838	V137A	possibly damaging	Het
Rgl2	T	A	17: 33,933,940	M441K	possibly damaging	Het
Sdhaf3	A	T	6: 6,956,072	I16F	possibly damaging	Het
Slc38a3	T	G	9: 107,657,649	N176H	probably benign	Het
Sos1	T	C	17: 80,449,356	S256G	possibly damaging	Het
Spg11	A	T	2: 122,088,185	C988S	probably damaging	Het
Sync	A	T	4: 129,306,654	Q451L	possibly damaging	Het
Tbc1d31	A	G	15: 57,967,933	Y929C	probably benign	Het
Thbs2	G	A	17: 14,689,968	T123I	probably damaging	Het
Thsd7a	A	C	6: 12,331,927		probably null	Het
Tnfrsf11a	T	C	1: 105,821,517	L220P	probably damaging	Het
Trbv13-2	G	A	6: 41,121,818	C109Y	probably damaging	Het
Ugt3a1	G	A	15: 9,306,360	W198*	probably null	Het
Usp14	G	A	18: 9,996,189	R464W	probably damaging	Het
Vmn1r2	C	T	4: 3,172,162	S27L	probably benign	Het
Vmn1r68	T	A	7: 10,528,031	N47Y	probably benign	Het
Zfc3h1	T	A	10: 115,427,039	Y1719*	probably null	Het

Other mutations in Isy1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0105:Isy1	UTSW	6	87819185	missense	probably damaging	1.00
R0105:Isy1	UTSW	6	87819185	missense	probably damaging	1.00
R0106:Isy1	UTSW	6	87819185	missense	probably damaging	1.00
R0106:Isy1	UTSW	6	87819185	missense	probably damaging	1.00
R0363:Isy1	UTSW	6	87819185	missense	probably damaging	1.00
R0718:Isy1	UTSW	6	87819176	missense	probably damaging	1.00
R0866:Isy1	UTSW	6	87819112	missense	probably benign	0.04
R0926:Isy1	UTSW	6	87819143	missense	probably benign
R1674:Isy1	UTSW	6	87834487	missense	probably damaging	1.00
R3783:Isy1	UTSW	6	87821545	missense	possibly damaging	0.70
R7320:Isy1	UTSW	6	87833706	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TTCCTGACCCTGGGATCG -3'
(R):5'- AATAATGGCTCTGCTTGCTTCTT -3'

Sequencing Primer
(F):5'- CTGGGATCGCACGCACC -3'
(R):5'- CCTGGAACTCACTTTGTAGACTAGG -3'

Posted On

2019-06-07