Mutagenetix > Incidental Mutations

Incidental Mutation 'R7162:Cubn'

557625

Institutional Source

Beutler Lab

Gene Symbol

Cubn

Ensembl Gene

ENSMUSG00000026726

Gene Name

cubilin (intrinsic factor-cobalamin receptor)

Synonyms

D2Wsu88e

MMRRC Submission

Accession Numbers

Genbank: NM_001081084; MGI: 1931256

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7162 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

13276338-13491813 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 13342498 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 2070 (Y2070H)

Ref Sequence

ENSEMBL: ENSMUSP00000089009 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091436]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000091436
AA Change: Y2070H

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000089009
Gene: ENSMUSG00000026726
AA Change: Y2070H

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
EGF	132	165	2.14e-5	SMART
EGF_CA	167	208	1.95e-8	SMART
EGF	213	258	2.85e-1	SMART
EGF_CA	260	301	2.66e-10	SMART
EGF_CA	302	345	7.07e-6	SMART
EGF	349	393	1.01e-1	SMART
EGF	398	430	3.73e-5	SMART
EGF_CA	432	468	8.63e-10	SMART
CUB	474	586	4.4e-21	SMART
CUB	590	702	3.82e-39	SMART
CUB	708	816	3.66e-18	SMART
CUB	817	928	3.09e-25	SMART
CUB	932	1042	1.29e-36	SMART
CUB	1048	1161	3.46e-37	SMART
CUB	1165	1277	7.24e-40	SMART
CUB	1278	1389	8.33e-31	SMART
CUB	1391	1506	3.08e-43	SMART
CUB	1510	1619	1.9e-34	SMART
CUB	1620	1734	7.24e-40	SMART
CUB	1738	1850	6.02e-37	SMART
CUB	1852	1963	1.57e-26	SMART
CUB	1978	2091	3.46e-28	SMART
CUB	2092	2213	2.88e-34	SMART
CUB	2217	2334	4.13e-35	SMART
CUB	2336	2448	3.1e-39	SMART
CUB	2452	2565	5.37e-34	SMART
CUB	2570	2687	3e-23	SMART
CUB	2689	2801	3.1e-39	SMART
CUB	2805	2919	2.36e-21	SMART
CUB	2920	3035	6.18e-25	SMART
CUB	3037	3150	5.16e-36	SMART
CUB	3157	3274	1.68e-35	SMART
CUB	3278	3393	7.17e-12	SMART
CUB	3395	3507	2.49e-29	SMART
CUB	3511	3623	2.4e-22	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

99% (85/86)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cubilin (CUBN) acts as a receptor for intrinsic factor-vitamin B12 complexes. The role of receptor is supported by the presence of 27 CUB domains. Cubulin is located within the epithelium of intestine and kidney. Mutations in CUBN may play a role in autosomal recessive megaloblastic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis, yolk sac and allantoic vasculature defects, embryonic and visceral endoderm defects, and lack somites. Heterozygotes display incomplete penetrance of premature death. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted, other(1) Gene trapped(3)

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akp3	C	T	1: 87,127,749	T506I	unknown	Het
Ank1	T	C	8: 23,132,354	W1640R	possibly damaging	Het
Atp2a2	A	G	5: 122,489,324	M126T	probably benign	Het
Bptf	A	T	11: 107,043,631		probably null	Het
Brat1	T	C	5: 140,710,249	V125A	probably benign	Het
Cables1	T	C	18: 11,926,366		probably null	Het
Cabp5	A	T	7: 13,401,335	M67L	probably damaging	Het
Cacna1b	A	C	2: 24,700,022	I558S	probably benign	Het
Ccdc166	A	G	15: 75,981,195	S308P	probably benign	Het
Cfap57	C	T	4: 118,614,931	V84I	probably benign	Het
Cfhr2	A	G	1: 139,813,526	V237A	probably benign	Het
Clybl	C	A	14: 122,371,320	S108*	probably null	Het
Cyp8b1	A	G	9: 121,915,711	F185S	probably damaging	Het
Dennd2c	T	A	3: 103,156,107	V620D	probably damaging	Het
Dis3l2	T	C	1: 87,044,030	F597L	possibly damaging	Het
Eif3f	G	A	7: 108,940,731	R282H	probably benign	Het
Ell	C	A	8: 70,578,909	R86S	possibly damaging	Het
Eppk1	A	G	15: 76,106,609	V2024A	possibly damaging	Het
Exoc6	T	C	19: 37,577,118	I214T	probably damaging	Het
Faim2	A	G	15: 99,521,167		probably null	Het
Gli1	A	G	10: 127,332,437	S516P	probably benign	Het
Gm18596	A	T	10: 77,742,200	S147T	unknown	Het
Gm19965	A	G	1: 116,822,365	Y592C	unknown	Het
Gng12	T	C	6: 67,017,301	S36P	unknown	Het
Gramd3	G	A	18: 56,485,457		probably null	Het
Hmcn1	T	A	1: 150,748,993	T1054S	probably benign	Het
Ifngr1	A	G	10: 19,609,353	T367A	probably benign	Het
Il21r	G	T	7: 125,632,311	V304L	probably benign	Het
Ino80d	G	A	1: 63,065,735	T394M	probably damaging	Het
Itfg2	C	T	6: 128,410,583	V380M	probably damaging	Het
Kcna5	C	T	6: 126,533,843	V441I	possibly damaging	Het
Kcp	T	A	6: 29,497,200		probably null	Het
Kdf1	C	T	4: 133,529,918	T375I	unknown	Het
Klk1b1	A	T	7: 43,969,247	D16V	probably damaging	Het
Krtap5-4	A	C	7: 142,303,598	T2P	unknown	Het
Lamtor1	A	G	7: 101,906,036	D13G	probably benign	Het
Lrp10	T	C	14: 54,465,706	V72A	possibly damaging	Het
Lrrc1	C	A	9: 77,432,190	A503S	probably benign	Het
Mylk	A	T	16: 34,922,529	D1137V	probably damaging	Het
Myo5b	C	G	18: 74,695,427	L717V	probably benign	Het
Myoz3	T	A	18: 60,576,413	R225S	probably damaging	Het
Myrf	A	G	19: 10,218,646	F335L	possibly damaging	Het
Nfib	A	C	4: 82,350,440	S292A	probably damaging	Het
Notch3	G	T	17: 32,146,449	H1096Q	probably damaging	Het
Nt5c1a	A	G	4: 123,214,105	R194G	probably benign	Het
Olfr76	A	G	19: 12,120,137	F192L	possibly damaging	Het
Olfr958	A	G	9: 39,550,229	I214T	probably damaging	Het
Parp4	A	G	14: 56,648,876	E1804G	unknown	Het
Pcdhac2	A	T	18: 37,145,787	I607L	probably benign	Het
Pcdhb5	A	G	18: 37,321,686	D373G	probably benign	Het
Pcf11	A	T	7: 92,664,013	V154E	probably damaging	Het
Pdia3	T	G	2: 121,429,521	D180E	probably benign	Het
Piezo2	C	A	18: 63,124,709	V313F	possibly damaging	Het
Pik3ap1	C	A	19: 41,321,526	A452S	probably benign	Het
Plb1	A	G	5: 32,349,663	K1194R	probably benign	Het
Pld3	A	C	7: 27,532,474	W431G	probably damaging	Het
Plekha3	T	C	2: 76,692,766		probably null	Het
Ppm1f	G	T	16: 16,914,193	R169L	probably damaging	Het
Ppp2r3d	A	G	9: 124,439,673	V60A		Het
Prop1	T	A	11: 50,952,054	D102V	probably damaging	Het
Rbm27	G	A	18: 42,314,027	G446R	unknown	Het
Rc3h2	C	A	2: 37,409,605	V138L	possibly damaging	Het
Rorc	G	A	3: 94,377,608		probably null	Het
Sardh	A	G	2: 27,197,690	V723A	possibly damaging	Het
Sart3	A	G	5: 113,762,835	Y181H	probably damaging	Het
Sbpl	A	T	17: 23,953,465	M160K	possibly damaging	Het
Sh3gl3	A	G	7: 82,284,142	S238G	probably benign	Het
Slc22a30	A	G	19: 8,336,717		probably null	Het
Slc3a1	A	T	17: 85,064,014	R665*	probably null	Het
Stk32a	C	A	18: 43,297,584	Y186*	probably null	Het
Stxbp6	T	C	12: 44,902,880	N89D	probably benign	Het
Svep1	A	G	4: 58,070,262	F2508S	possibly damaging	Het
Tas1r1	A	G	4: 152,032,238	V313A	possibly damaging	Het
Tmem81	T	C	1: 132,507,617	Y54H	probably damaging	Het
Tmtc1	T	C	6: 148,271,487	N582S	probably damaging	Het
Top2b	T	C	14: 16,416,653	S1138P	probably benign	Het
Trim24	T	A	6: 37,965,521	N989K	possibly damaging	Het
Trim72	T	A	7: 128,007,649	M145K	probably benign	Het
Ttll9	T	A	2: 152,989,603	S154T	probably damaging	Het
Tusc3	T	C	8: 39,126,587	V286A	probably benign	Het
Vat1l	C	A	8: 114,236,778	H185N	probably damaging	Het
Vmn1r209	A	T	13: 22,805,958	D187E	probably damaging	Het
Vmn2r87	T	C	10: 130,477,547	N450S	probably benign	Het
Wdr7	T	A	18: 63,724,139	D95E	possibly damaging	Het
Zfp937	C	T	2: 150,239,519	H490Y	probably benign	Het
Zfp974	A	T	7: 27,911,519	H260Q	possibly damaging	Het

Other mutations in Cubn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Cubn	APN	2	13491820	unclassified	probably benign
IGL00228:Cubn	APN	2	13456697	missense	probably damaging	1.00
IGL00231:Cubn	APN	2	13381849	missense	possibly damaging	0.89
IGL00327:Cubn	APN	2	13427056	missense	possibly damaging	0.73
IGL00470:Cubn	APN	2	13278418	missense	probably benign	0.00
IGL00519:Cubn	APN	2	13282919	missense	probably benign	0.00
IGL00562:Cubn	APN	2	13294230	missense	probably benign	0.01
IGL00678:Cubn	APN	2	13467710	missense	possibly damaging	0.47
IGL00834:Cubn	APN	2	13381927	missense	probably damaging	1.00
IGL00946:Cubn	APN	2	13456623	missense	probably damaging	0.98
IGL00971:Cubn	APN	2	13278408	missense	possibly damaging	0.77
IGL01124:Cubn	APN	2	13478093	missense	possibly damaging	0.62
IGL01287:Cubn	APN	2	13310566	missense	probably damaging	1.00
IGL01410:Cubn	APN	2	13465908	missense	probably benign	0.31
IGL01418:Cubn	APN	2	13284041	missense	probably benign	0.01
IGL01450:Cubn	APN	2	13350862	splice site	probably benign
IGL01534:Cubn	APN	2	13465933	nonsense	probably null
IGL01584:Cubn	APN	2	13308661	splice site	probably benign
IGL01595:Cubn	APN	2	13325216	missense	probably benign	0.05
IGL01625:Cubn	APN	2	13306274	missense	possibly damaging	0.76
IGL01732:Cubn	APN	2	13489936	nonsense	probably null
IGL01972:Cubn	APN	2	13446072	missense	possibly damaging	0.90
IGL02027:Cubn	APN	2	13287594	missense	probably damaging	1.00
IGL02033:Cubn	APN	2	13339846	missense	probably damaging	0.98
IGL02124:Cubn	APN	2	13381837	missense	probably damaging	0.99
IGL02335:Cubn	APN	2	13427834	splice site	probably null
IGL02491:Cubn	APN	2	13321228	missense	probably damaging	1.00
IGL02686:Cubn	APN	2	13325226	missense	possibly damaging	0.92
IGL02707:Cubn	APN	2	13446032	missense	probably damaging	0.99
IGL02746:Cubn	APN	2	13445040	missense	probably damaging	1.00
IGL02873:Cubn	APN	2	13294370	missense	probably benign	0.07
IGL02897:Cubn	APN	2	13318312	missense	possibly damaging	0.55
IGL03078:Cubn	APN	2	13287094	missense	possibly damaging	0.87
IGL03245:Cubn	APN	2	13355689	missense	probably benign	0.09
IGL03289:Cubn	APN	2	13426967	missense	probably benign	0.00
IGL03335:Cubn	APN	2	13360329	missense	probably damaging	1.00
IGL03355:Cubn	APN	2	13478057	splice site	probably null
mellow	UTSW	2	13478078	missense	probably damaging	1.00
PIT4354001:Cubn	UTSW	2	13468852	nonsense	probably null
PIT4495001:Cubn	UTSW	2	13491750	missense	probably benign	0.00
R0145:Cubn	UTSW	2	13306432	missense	probably damaging	1.00
R0220:Cubn	UTSW	2	13356709	missense	probably damaging	1.00
R0254:Cubn	UTSW	2	13424694	missense	probably benign	0.01
R0254:Cubn	UTSW	2	13440514	missense	possibly damaging	0.84
R0254:Cubn	UTSW	2	13476035	critical splice donor site	probably null
R0360:Cubn	UTSW	2	13310507	splice site	probably benign
R0364:Cubn	UTSW	2	13310507	splice site	probably benign
R0383:Cubn	UTSW	2	13430959	missense	probably damaging	1.00
R0419:Cubn	UTSW	2	13469763	missense	possibly damaging	0.77
R0419:Cubn	UTSW	2	13469764	missense	possibly damaging	0.87
R0498:Cubn	UTSW	2	13444267	missense	probably damaging	0.99
R0560:Cubn	UTSW	2	13428680	missense	probably damaging	1.00
R0615:Cubn	UTSW	2	13360252	splice site	probably null
R0735:Cubn	UTSW	2	13491689	splice site	probably benign
R0780:Cubn	UTSW	2	13456613	missense	probably damaging	1.00
R0899:Cubn	UTSW	2	13362328	missense	possibly damaging	0.54
R1118:Cubn	UTSW	2	13336242	missense	possibly damaging	0.78
R1182:Cubn	UTSW	2	13445000	missense	probably damaging	0.98
R1439:Cubn	UTSW	2	13287568	missense	probably damaging	0.96
R1450:Cubn	UTSW	2	13360319	missense	probably damaging	1.00
R1464:Cubn	UTSW	2	13325288	missense	possibly damaging	0.87
R1464:Cubn	UTSW	2	13325288	missense	possibly damaging	0.87
R1476:Cubn	UTSW	2	13476120	missense	probably benign	0.04
R1508:Cubn	UTSW	2	13427105	missense	probably benign	0.25
R1532:Cubn	UTSW	2	13287661	missense	probably damaging	1.00
R1562:Cubn	UTSW	2	13427967	missense	probably damaging	1.00
R1598:Cubn	UTSW	2	13469789	missense	probably benign	0.00
R1761:Cubn	UTSW	2	13489317	critical splice donor site	probably null
R1862:Cubn	UTSW	2	13308561	missense	probably damaging	1.00
R1874:Cubn	UTSW	2	13323002	missense	probably damaging	1.00
R1923:Cubn	UTSW	2	13310526	missense	probably damaging	1.00
R1944:Cubn	UTSW	2	13278538	missense	probably benign	0.01
R1960:Cubn	UTSW	2	13340017	splice site	probably null
R2021:Cubn	UTSW	2	13308549	missense	probably benign	0.09
R2137:Cubn	UTSW	2	13336167	missense	probably benign	0.01
R2138:Cubn	UTSW	2	13444378	missense	probably damaging	0.99
R2139:Cubn	UTSW	2	13336167	missense	probably benign	0.01
R2179:Cubn	UTSW	2	13318242	missense	possibly damaging	0.85
R2328:Cubn	UTSW	2	13404080	nonsense	probably null
R2369:Cubn	UTSW	2	13491217	missense	probably damaging	1.00
R2428:Cubn	UTSW	2	13476150	missense	probably damaging	1.00
R2435:Cubn	UTSW	2	13318272	missense	probably damaging	1.00
R2567:Cubn	UTSW	2	13278356	splice site	probably null
R2850:Cubn	UTSW	2	13322953	missense	probably damaging	1.00
R2853:Cubn	UTSW	2	13430834	missense	probably benign	0.00
R2893:Cubn	UTSW	2	13358139	missense	possibly damaging	0.61
R3107:Cubn	UTSW	2	13362347	missense	possibly damaging	0.73
R3109:Cubn	UTSW	2	13362347	missense	possibly damaging	0.73
R3119:Cubn	UTSW	2	13358162	missense	possibly damaging	0.90
R3405:Cubn	UTSW	2	13333508	missense	probably benign	0.00
R3703:Cubn	UTSW	2	13350943	missense	probably damaging	1.00
R3704:Cubn	UTSW	2	13350943	missense	probably damaging	1.00
R3705:Cubn	UTSW	2	13350943	missense	probably damaging	1.00
R3764:Cubn	UTSW	2	13331585	missense	possibly damaging	0.79
R3792:Cubn	UTSW	2	13427914	missense	probably damaging	1.00
R3802:Cubn	UTSW	2	13360353	missense	probably benign	0.01
R3813:Cubn	UTSW	2	13294325	missense	probably damaging	1.00
R3845:Cubn	UTSW	2	13283008	missense	probably damaging	1.00
R3846:Cubn	UTSW	2	13283008	missense	probably damaging	1.00
R3900:Cubn	UTSW	2	13286980	critical splice donor site	probably null
R3921:Cubn	UTSW	2	13326677	missense	probably damaging	1.00
R4075:Cubn	UTSW	2	13313999	missense	possibly damaging	0.58
R4082:Cubn	UTSW	2	13428563	intron	probably benign
R4405:Cubn	UTSW	2	13466030	missense	probably damaging	1.00
R4615:Cubn	UTSW	2	13428749	missense	probably damaging	1.00
R4629:Cubn	UTSW	2	13313979	splice site	probably null
R4770:Cubn	UTSW	2	13314767	missense	possibly damaging	0.92
R4799:Cubn	UTSW	2	13287024	missense	possibly damaging	0.94
R4799:Cubn	UTSW	2	13351058	missense	probably damaging	1.00
R4812:Cubn	UTSW	2	13459076	missense	probably damaging	1.00
R4825:Cubn	UTSW	2	13325225	missense	probably damaging	1.00
R4934:Cubn	UTSW	2	13489910	missense	probably benign	0.06
R4967:Cubn	UTSW	2	13348045	missense	probably benign	0.01
R5187:Cubn	UTSW	2	13287568	missense	probably damaging	0.96
R5232:Cubn	UTSW	2	13478202	nonsense	probably null
R5305:Cubn	UTSW	2	13388939	missense	probably damaging	1.00
R5506:Cubn	UTSW	2	13491695	splice site	probably null
R5530:Cubn	UTSW	2	13308523	missense	probably damaging	1.00
R5531:Cubn	UTSW	2	13350932	missense	probably benign	0.00
R5737:Cubn	UTSW	2	13388891	missense	probably damaging	1.00
R5886:Cubn	UTSW	2	13320023	splice site	probably benign
R5923:Cubn	UTSW	2	13486078	missense	possibly damaging	0.73
R6032:Cubn	UTSW	2	13325184	missense	probably benign	0.12
R6032:Cubn	UTSW	2	13325184	missense	probably benign	0.12
R6084:Cubn	UTSW	2	13430897	missense	probably damaging	1.00
R6087:Cubn	UTSW	2	13427847	missense	probably damaging	1.00
R6133:Cubn	UTSW	2	13308618	missense	probably benign	0.29
R6181:Cubn	UTSW	2	13349876	missense	probably benign	0.31
R6301:Cubn	UTSW	2	13478078	missense	probably damaging	1.00
R6320:Cubn	UTSW	2	13280195	missense	probably damaging	1.00
R6368:Cubn	UTSW	2	13430995	missense	probably damaging	0.96
R6368:Cubn	UTSW	2	13476123	missense	probably damaging	0.98
R6383:Cubn	UTSW	2	13427835	critical splice donor site	probably null
R6393:Cubn	UTSW	2	13355680	missense	probably benign	0.08
R6408:Cubn	UTSW	2	13294203	missense	probably damaging	1.00
R6470:Cubn	UTSW	2	13322993	missense	possibly damaging	0.87
R6532:Cubn	UTSW	2	13459002	missense	probably benign	0.01
R6599:Cubn	UTSW	2	13310673	missense	possibly damaging	0.95
R6629:Cubn	UTSW	2	13430872	missense	probably damaging	1.00
R6641:Cubn	UTSW	2	13476064	missense	probably damaging	1.00
R6800:Cubn	UTSW	2	13321255	missense	probably damaging	1.00
R6823:Cubn	UTSW	2	13445029	missense	probably benign	0.21
R6847:Cubn	UTSW	2	13444253	critical splice donor site	probably null
R6885:Cubn	UTSW	2	13318278	missense	probably damaging	1.00
R6962:Cubn	UTSW	2	13348029	missense	probably benign	0.03
R6973:Cubn	UTSW	2	13381837	missense	possibly damaging	0.61
R6975:Cubn	UTSW	2	13486789	missense	probably damaging	0.99
R7076:Cubn	UTSW	2	13306280	missense	probably benign	0.00
R7076:Cubn	UTSW	2	13306281	missense	probably benign	0.10
R7086:Cubn	UTSW	2	13319858	missense	probably damaging	0.98
R7203:Cubn	UTSW	2	13351003	missense	probably benign	0.01
R7292:Cubn	UTSW	2	13424739	missense	probably damaging	0.99
R7307:Cubn	UTSW	2	13340332	missense	probably damaging	0.99
R7329:Cubn	UTSW	2	13468771	missense	probably damaging	0.99
R7395:Cubn	UTSW	2	13287064	missense	probably damaging	1.00
R7417:Cubn	UTSW	2	13426967	missense	probably benign	0.00
R7429:Cubn	UTSW	2	13322993	missense	possibly damaging	0.87
R7430:Cubn	UTSW	2	13322993	missense	possibly damaging	0.87
R7443:Cubn	UTSW	2	13455509	missense	probably damaging	1.00
R7699:Cubn	UTSW	2	13348178	missense	probably benign
R7699:Cubn	UTSW	2	13489917	missense	possibly damaging	0.74
R7700:Cubn	UTSW	2	13348178	missense	probably benign
R7700:Cubn	UTSW	2	13489917	missense	possibly damaging	0.74
R7751:Cubn	UTSW	2	13360365	missense	probably damaging	1.00
R7755:Cubn	UTSW	2	13280078	missense	probably benign	0.11
R7759:Cubn	UTSW	2	13348150	missense	probably damaging	1.00
R7903:Cubn	UTSW	2	13468869	missense	probably damaging	0.97
R7921:Cubn	UTSW	2	13424727	missense	probably benign	0.22
R7988:Cubn	UTSW	2	13332355	missense	probably benign	0.43
R8010:Cubn	UTSW	2	13336086	critical splice donor site	probably null
R8020:Cubn	UTSW	2	13479178	missense	probably benign	0.01
R8120:Cubn	UTSW	2	13331660	missense	probably damaging	1.00
R8133:Cubn	UTSW	2	13388848	missense	probably damaging	1.00
R8185:Cubn	UTSW	2	13294318	missense	probably benign	0.11
R8224:Cubn	UTSW	2	13349877	missense	probably benign	0.16
R8289:Cubn	UTSW	2	13486802	missense	probably benign	0.10
R8326:Cubn	UTSW	2	13306463	missense	probably benign	0.01
R8331:Cubn	UTSW	2	13340242	missense	probably damaging	1.00
R8338:Cubn	UTSW	2	13430847	missense	probably benign	0.08
R8341:Cubn	UTSW	2	13428724	missense	probably damaging	1.00
R8358:Cubn	UTSW	2	13325160	missense	probably benign	0.17
R8427:Cubn	UTSW	2	13428756	missense	probably benign	0.00
R8432:Cubn	UTSW	2	13381799	missense	probably benign	0.00
R8441:Cubn	UTSW	2	13427847	missense	probably damaging	1.00
R8442:Cubn	UTSW	2	13314044	missense	probably damaging	1.00
R8520:Cubn	UTSW	2	13308520	critical splice donor site	probably null
R8699:Cubn	UTSW	2	13383959	missense	probably damaging	1.00
R8753:Cubn	UTSW	2	13308566	nonsense	probably null
R8874:Cubn	UTSW	2	13360346	missense	possibly damaging	0.63
R9056:Cubn	UTSW	2	13456655	missense	probably damaging	1.00
R9079:Cubn	UTSW	2	13287103	missense	probably benign	0.02
R9261:Cubn	UTSW	2	13278451	missense	probably damaging	1.00
R9338:Cubn	UTSW	2	13381892	missense	probably damaging	1.00
R9342:Cubn	UTSW	2	13458956	missense	probably damaging	0.99
X0018:Cubn	UTSW	2	13458986	missense	probably damaging	1.00
X0022:Cubn	UTSW	2	13476076	missense	probably damaging	1.00
X0026:Cubn	UTSW	2	13342581	missense	probably damaging	1.00
X0063:Cubn	UTSW	2	13322962	missense	probably damaging	1.00
YA93:Cubn	UTSW	2	13383992	missense	probably benign	0.21
Z1088:Cubn	UTSW	2	13294229	missense	probably benign	0.43
Z1176:Cubn	UTSW	2	13381825	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGGGCAGAGGGAGACATTTT -3'
(R):5'- AACGTGTGTGGTCTGAGAAAA -3'

Sequencing Primer
(F):5'- TACAAAGAAGAGGACAGAAATAATGG -3'
(R):5'- CGTGTGTGGTCTGAGAAAAATATG -3'

Posted On

2019-06-26