Incidental Mutation 'R7162:Mylk'
ID557684
Institutional Source Beutler Lab
Gene Symbol Mylk
Ensembl Gene ENSMUSG00000022836
Gene Namemyosin, light polypeptide kinase
SynonymsMlck, nmMlck, telokin, A930019C19Rik, 9530072E15Rik, MLCK108, MLCK210
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7162 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location34745210-35002420 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34922529 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 1137 (D1137V)
Ref Sequence ENSEMBL: ENSMUSP00000023538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023538]
Predicted Effect probably damaging
Transcript: ENSMUST00000023538
AA Change: D1137V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000023538
Gene: ENSMUSG00000022836
AA Change: D1137V

DomainStartEndE-ValueType
IGc2 54 122 9.05e-11 SMART
IGc2 177 244 3.94e-11 SMART
Pfam:23ISL 255 409 3.6e-60 PFAM
IGc2 423 491 1.55e-9 SMART
IGc2 523 587 3.32e-18 SMART
IGc2 632 699 6.02e-7 SMART
IGc2 730 798 1.36e-5 SMART
low complexity region 827 844 N/A INTRINSIC
IGc2 1141 1208 2.42e-11 SMART
low complexity region 1251 1269 N/A INTRINSIC
IG 1275 1359 4.56e-7 SMART
FN3 1362 1444 2.33e-11 SMART
low complexity region 1457 1479 N/A INTRINSIC
S_TKc 1495 1750 4.23e-95 SMART
IGc2 1852 1920 5.92e-15 SMART
low complexity region 1934 1950 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (85/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene, a muscle member of the immunoglobulin gene superfamily, encodes myosin light chain kinase which is a calcium/calmodulin dependent enzyme. This kinase phosphorylates myosin regulatory light chains to facilitate myosin interaction with actin filaments to produce contractile activity. This gene encodes both smooth muscle and nonmuscle isoforms. In addition, using a separate promoter in an intron in the 3' region, it encodes telokin, a small protein identical in sequence to the C-terminus of myosin light chain kinase, that is independently expressed in smooth muscle and functions to stabilize unphosphorylated myosin filaments. A pseudogene is located on the p arm of chromosome 3. Four transcript variants that produce four isoforms of the calcium/calmodulin dependent enzyme have been identified as well as two transcripts that produce two isoforms of telokin. Additional variants have been identified but lack full length transcripts. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that lack the isoform abundant in endothelial cells show a reduced susceptibility to acute lung injury. Mice lacking the smooth muscle isoform exhibit partial pre- or neonatal lethality, short small intestine and impaired smooth muscle contraction in the colon. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akp3 C T 1: 87,127,749 T506I unknown Het
Ank1 T C 8: 23,132,354 W1640R possibly damaging Het
Atp2a2 A G 5: 122,489,324 M126T probably benign Het
Bptf A T 11: 107,043,631 probably null Het
Brat1 T C 5: 140,710,249 V125A probably benign Het
Cables1 T C 18: 11,926,366 probably null Het
Cabp5 A T 7: 13,401,335 M67L probably damaging Het
Cacna1b A C 2: 24,700,022 I558S probably benign Het
Ccdc166 A G 15: 75,981,195 S308P probably benign Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Cfhr2 A G 1: 139,813,526 V237A probably benign Het
Clybl C A 14: 122,371,320 S108* probably null Het
Cubn A G 2: 13,342,498 Y2070H probably damaging Het
Cyp8b1 A G 9: 121,915,711 F185S probably damaging Het
Dennd2c T A 3: 103,156,107 V620D probably damaging Het
Dis3l2 T C 1: 87,044,030 F597L possibly damaging Het
Eif3f G A 7: 108,940,731 R282H probably benign Het
Ell C A 8: 70,578,909 R86S possibly damaging Het
Eppk1 A G 15: 76,106,609 V2024A possibly damaging Het
Exoc6 T C 19: 37,577,118 I214T probably damaging Het
Faim2 A G 15: 99,521,167 probably null Het
Gli1 A G 10: 127,332,437 S516P probably benign Het
Gm18596 A T 10: 77,742,200 S147T unknown Het
Gm19965 A G 1: 116,822,365 Y592C unknown Het
Gng12 T C 6: 67,017,301 S36P unknown Het
Gramd3 G A 18: 56,485,457 probably null Het
Hmcn1 T A 1: 150,748,993 T1054S probably benign Het
Ifngr1 A G 10: 19,609,353 T367A probably benign Het
Il21r G T 7: 125,632,311 V304L probably benign Het
Ino80d G A 1: 63,065,735 T394M probably damaging Het
Itfg2 C T 6: 128,410,583 V380M probably damaging Het
Kcna5 C T 6: 126,533,843 V441I possibly damaging Het
Kcp T A 6: 29,497,200 probably null Het
Kdf1 C T 4: 133,529,918 T375I unknown Het
Klk1b1 A T 7: 43,969,247 D16V probably damaging Het
Krtap5-4 A C 7: 142,303,598 T2P unknown Het
Lamtor1 A G 7: 101,906,036 D13G probably benign Het
Lrp10 T C 14: 54,465,706 V72A possibly damaging Het
Lrrc1 C A 9: 77,432,190 A503S probably benign Het
Myo5b C G 18: 74,695,427 L717V probably benign Het
Myoz3 T A 18: 60,576,413 R225S probably damaging Het
Myrf A G 19: 10,218,646 F335L possibly damaging Het
Nfib A C 4: 82,350,440 S292A probably damaging Het
Notch3 G T 17: 32,146,449 H1096Q probably damaging Het
Nt5c1a A G 4: 123,214,105 R194G probably benign Het
Olfr76 A G 19: 12,120,137 F192L possibly damaging Het
Olfr958 A G 9: 39,550,229 I214T probably damaging Het
Parp4 A G 14: 56,648,876 E1804G unknown Het
Pcdhac2 A T 18: 37,145,787 I607L probably benign Het
Pcdhb5 A G 18: 37,321,686 D373G probably benign Het
Pcf11 A T 7: 92,664,013 V154E probably damaging Het
Pdia3 T G 2: 121,429,521 D180E probably benign Het
Piezo2 C A 18: 63,124,709 V313F possibly damaging Het
Pik3ap1 C A 19: 41,321,526 A452S probably benign Het
Plb1 A G 5: 32,349,663 K1194R probably benign Het
Pld3 A C 7: 27,532,474 W431G probably damaging Het
Plekha3 T C 2: 76,692,766 probably null Het
Ppm1f G T 16: 16,914,193 R169L probably damaging Het
Ppp2r3d A G 9: 124,439,673 V60A Het
Prop1 T A 11: 50,952,054 D102V probably damaging Het
Rbm27 G A 18: 42,314,027 G446R unknown Het
Rc3h2 C A 2: 37,409,605 V138L possibly damaging Het
Rorc G A 3: 94,377,608 probably null Het
Sardh A G 2: 27,197,690 V723A possibly damaging Het
Sart3 A G 5: 113,762,835 Y181H probably damaging Het
Sbpl A T 17: 23,953,465 M160K possibly damaging Het
Sh3gl3 A G 7: 82,284,142 S238G probably benign Het
Slc22a30 A G 19: 8,336,717 probably null Het
Slc3a1 A T 17: 85,064,014 R665* probably null Het
Stk32a C A 18: 43,297,584 Y186* probably null Het
Stxbp6 T C 12: 44,902,880 N89D probably benign Het
Svep1 A G 4: 58,070,262 F2508S possibly damaging Het
Tas1r1 A G 4: 152,032,238 V313A possibly damaging Het
Tmem81 T C 1: 132,507,617 Y54H probably damaging Het
Tmtc1 T C 6: 148,271,487 N582S probably damaging Het
Top2b T C 14: 16,416,653 S1138P probably benign Het
Trim24 T A 6: 37,965,521 N989K possibly damaging Het
Trim72 T A 7: 128,007,649 M145K probably benign Het
Ttll9 T A 2: 152,989,603 S154T probably damaging Het
Tusc3 T C 8: 39,126,587 V286A probably benign Het
Vat1l C A 8: 114,236,778 H185N probably damaging Het
Vmn1r209 A T 13: 22,805,958 D187E probably damaging Het
Vmn2r87 T C 10: 130,477,547 N450S probably benign Het
Wdr7 T A 18: 63,724,139 D95E possibly damaging Het
Zfp937 C T 2: 150,239,519 H490Y probably benign Het
Zfp974 A T 7: 27,911,519 H260Q possibly damaging Het
Other mutations in Mylk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01384:Mylk APN 16 34938952 missense probably benign 0.36
IGL01386:Mylk APN 16 34971240 critical splice acceptor site probably null
IGL01684:Mylk APN 16 34971940 missense possibly damaging 0.55
IGL01884:Mylk APN 16 34988877 splice site probably benign
IGL02079:Mylk APN 16 34860631 missense possibly damaging 0.87
IGL02104:Mylk APN 16 34815435 missense probably benign 0.06
IGL02624:Mylk APN 16 34929896 missense probably benign 0.29
IGL02756:Mylk APN 16 34963646 missense probably benign 0.42
IGL02794:Mylk APN 16 34986541 missense probably benign 0.21
IGL02833:Mylk APN 16 34914900 missense probably benign 0.01
IGL02946:Mylk APN 16 34921788 missense probably benign 0.10
IGL03012:Mylk APN 16 34952781 missense probably benign 0.03
IGL03093:Mylk APN 16 34912192 missense possibly damaging 0.62
IGL03272:Mylk APN 16 34979189 missense probably benign 0.09
billy UTSW 16 34875620 missense probably damaging 0.97
brutus UTSW 16 34953695 missense probably benign 0.12
Club UTSW 16 34912275 nonsense probably null
popeye UTSW 16 34963577 missense probably benign 0.29
F5770:Mylk UTSW 16 34995204 critical splice donor site probably null
P4717OSA:Mylk UTSW 16 34977113 splice site probably benign
PIT4382001:Mylk UTSW 16 34875642 missense probably damaging 0.99
R0131:Mylk UTSW 16 34875504 missense probably benign 0.03
R0309:Mylk UTSW 16 34912297 splice site probably benign
R0358:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0381:Mylk UTSW 16 34784974 splice site probably null
R0390:Mylk UTSW 16 34875620 missense probably damaging 0.97
R0413:Mylk UTSW 16 34921944 missense probably benign 0.01
R0536:Mylk UTSW 16 35000387 missense possibly damaging 0.95
R0544:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0545:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0546:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0547:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0548:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0627:Mylk UTSW 16 35000429 missense probably damaging 1.00
R0726:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0755:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0782:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0783:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R0784:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R1136:Mylk UTSW 16 35000318 missense probably damaging 1.00
R1170:Mylk UTSW 16 34874039 missense probably benign 0.20
R1222:Mylk UTSW 16 34860652 missense probably benign 0.12
R1445:Mylk UTSW 16 34815465 missense possibly damaging 0.57
R1583:Mylk UTSW 16 34875586 missense probably benign 0.29
R1618:Mylk UTSW 16 34879475 missense possibly damaging 0.74
R1643:Mylk UTSW 16 34875635 missense probably benign 0.03
R1702:Mylk UTSW 16 34921944 missense probably benign 0.00
R1776:Mylk UTSW 16 34952782 missense probably benign 0.16
R1865:Mylk UTSW 16 34912230 missense probably benign 0.03
R1975:Mylk UTSW 16 34880303 splice site probably null
R2016:Mylk UTSW 16 34996817 missense probably damaging 1.00
R2045:Mylk UTSW 16 34953653 missense probably benign 0.29
R2134:Mylk UTSW 16 34986476 missense probably benign 0.13
R3547:Mylk UTSW 16 34880168 missense possibly damaging 0.61
R3844:Mylk UTSW 16 34921877 missense probably benign 0.01
R4003:Mylk UTSW 16 34963577 missense probably benign 0.29
R4396:Mylk UTSW 16 34912275 nonsense probably null
R4470:Mylk UTSW 16 34912152 missense probably benign 0.09
R4507:Mylk UTSW 16 34953695 missense probably benign 0.12
R4700:Mylk UTSW 16 34922435 missense probably benign 0.16
R4751:Mylk UTSW 16 34879169 missense probably benign 0.29
R4815:Mylk UTSW 16 34894925 missense probably damaging 0.97
R4832:Mylk UTSW 16 34922367 missense probably benign 0.36
R4872:Mylk UTSW 16 34914990 missense possibly damaging 0.89
R4953:Mylk UTSW 16 34988961 missense probably damaging 1.00
R4969:Mylk UTSW 16 34971440 missense probably damaging 0.96
R5009:Mylk UTSW 16 34899507 missense probably benign 0.39
R5130:Mylk UTSW 16 34988997 missense probably damaging 1.00
R5173:Mylk UTSW 16 34977013 missense probably benign 0.40
R5195:Mylk UTSW 16 34979215 missense probably damaging 1.00
R5209:Mylk UTSW 16 34922625 missense possibly damaging 0.55
R5311:Mylk UTSW 16 34921757 missense probably benign 0.01
R5418:Mylk UTSW 16 34912230 missense probably benign 0.02
R5481:Mylk UTSW 16 34921604 missense probably benign 0.09
R5590:Mylk UTSW 16 34879352 missense probably benign 0.29
R5603:Mylk UTSW 16 34956492 missense probably benign 0.06
R5823:Mylk UTSW 16 34894947 critical splice donor site probably null
R6290:Mylk UTSW 16 34894843 missense probably benign 0.39
R6351:Mylk UTSW 16 34921971 missense probably benign 0.01
R6365:Mylk UTSW 16 34860591 missense probably benign 0.12
R6490:Mylk UTSW 16 34929867 missense possibly damaging 0.74
R6723:Mylk UTSW 16 34929888 missense possibly damaging 0.74
R6864:Mylk UTSW 16 34874150 missense probably benign 0.03
R6908:Mylk UTSW 16 34880273 missense probably benign 0.18
R6949:Mylk UTSW 16 35000318 missense probably damaging 1.00
R7018:Mylk UTSW 16 35000426 missense possibly damaging 0.88
R7035:Mylk UTSW 16 34976982 missense possibly damaging 0.89
R7236:Mylk UTSW 16 34922529 missense probably damaging 1.00
R7269:Mylk UTSW 16 34785011 missense probably damaging 0.96
R7475:Mylk UTSW 16 34914076 splice site probably null
R7525:Mylk UTSW 16 34988987 missense probably benign 0.06
R7587:Mylk UTSW 16 34922517 missense probably benign 0.29
R7607:Mylk UTSW 16 34894814 missense probably benign 0.09
R7616:Mylk UTSW 16 34879557 missense probably damaging 0.97
R7647:Mylk UTSW 16 34879524 missense probably benign 0.29
R7648:Mylk UTSW 16 34879524 missense probably benign 0.29
R7764:Mylk UTSW 16 34922183 missense probably benign 0.16
R7890:Mylk UTSW 16 34963648 nonsense probably null
R7892:Mylk UTSW 16 34879524 missense probably benign 0.29
R7893:Mylk UTSW 16 34879524 missense probably benign 0.29
R8065:Mylk UTSW 16 34972019 missense probably benign 0.08
R8067:Mylk UTSW 16 34972019 missense probably benign 0.08
R8143:Mylk UTSW 16 34914155 missense possibly damaging 0.87
R8210:Mylk UTSW 16 35000351 missense probably damaging 1.00
R8271:Mylk UTSW 16 34922579 missense probably damaging 0.97
RF001:Mylk UTSW 16 34879371 missense probably benign 0.03
V7580:Mylk UTSW 16 34995204 critical splice donor site probably null
V7583:Mylk UTSW 16 34995204 critical splice donor site probably null
X0065:Mylk UTSW 16 35000441 missense probably damaging 1.00
Z1177:Mylk UTSW 16 34922651 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- GGGTCCCTGAAACCTGTAAC -3'
(R):5'- TTTGACAGTGACCCATGGATG -3'

Sequencing Primer
(F):5'- TGAGCCCCAGAAGCCTGTG -3'
(R):5'- GGGCTTCCCATCTTCCCTAC -3'
Posted On2019-06-26