Mutagenetix > Incidental Mutations

Incidental Mutation 'R7166:Slc26a2'

557961

Institutional Source

Beutler Lab

Gene Symbol

Slc26a2

Ensembl Gene

ENSMUSG00000034320

Gene Name

solute carrier family 26 (sulfate transporter), member 2

Synonyms

Dtd, ST-OB

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.267) question?

Stock #

R7166 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

61192919-61211612 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 61198829 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 510 (M510K)

Ref Sequence

ENSEMBL: ENSMUSP00000119447 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037603] [ENSMUST00000146409] [ENSMUST00000148829]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000037603
AA Change: M275K

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000040163
Gene: ENSMUSG00000034320
AA Change: M275K

Domain	Start	End	E-Value	Type
Pfam:Sulfate_transp	1	279	5.8e-83	PFAM
low complexity region	317	330	N/A	INTRINSIC
Pfam:STAS	334	480	5.8e-30	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000146409
AA Change: M510K

PolyPhen 2 Score 0.883 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000119447
Gene: ENSMUSG00000034320
AA Change: M510K

Domain	Start	End	E-Value	Type
Pfam:Sulfate_transp	108	518	1.8e-133	PFAM
low complexity region	552	565	N/A	INTRINSIC
Pfam:STAS	569	715	2.1e-29	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000148829

SMART Domains

Protein: ENSMUSP00000114419
Gene: ENSMUSG00000034320

Domain	Start	End	E-Value	Type
Pfam:Sulfate_tra_GLY	93	176	1.1e-33	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (52/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The diastrophic dysplasia sulfate transporter is a transmembrane glycoprotein implicated in the pathogenesis of several human chondrodysplasias. It apparently is critical in cartilage for sulfation of proteoglycans and matrix organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit premature death, stunted growth, joint contractures, and skeletal dysplasia including kyphosis, shorter osteoporotic long bones, aberrant chondrocyte size, delayed endochondral bone ossification, and impairedchondrocyte proliferation and sulfate uptake. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ambn	T	C	5: 88,467,528	L272P	possibly damaging	Het
Ash2l	C	A	8: 25,827,320	G335V	probably damaging	Het
Atp13a1	T	A	8: 69,799,316		probably null	Het
Atp13a2	G	A	4: 141,006,984	R1139Q	possibly damaging	Het
Atxn2	T	A	5: 121,796,397	N886K	possibly damaging	Het
Celsr3	G	T	9: 108,842,951	C2512F	probably damaging	Het
Cfap221	A	G	1: 119,948,113	V449A	probably benign	Het
Cfhr2	A	T	1: 139,831,101	C70*	probably null	Het
Chfr	C	A	5: 110,158,805	P472Q	probably benign	Het
Crybg2	G	A	4: 134,060,882	R22Q	probably damaging	Het
Eef2k	T	C	7: 120,884,772	F244L	probably damaging	Het
Efcab11	A	T	12: 99,883,355	M23K		Het
Ercc8	T	A	13: 108,169,433	M114K	possibly damaging	Het
Fam217a	T	C	13: 34,910,315	Y487C	probably benign	Het
Farsb	T	C	1: 78,471,184	N205S	probably benign	Het
Glra1	A	G	11: 55,515,078	F370S	probably benign	Het
Gm12258	T	A	11: 58,858,473	M158K		Het
Gm14305	T	A	2: 176,720,943	H209Q	probably damaging	Het
Gm4924	A	T	10: 82,378,201	Q611L	unknown	Het
Gm5580	A	G	6: 116,551,368	I69V	probably benign	Het
Haus6	T	C	4: 86,583,687	E649G	possibly damaging	Het
Hist1h4j	A	G	13: 21,735,151	H19R	unknown	Het
Hlcs	C	T	16: 94,262,726	D345N	possibly damaging	Het
Htt	C	A	5: 34,852,894	Q1564K	probably benign	Het
Itpr1	G	A	6: 108,378,190	V481I	probably benign	Het
Jak3	T	C	8: 71,682,316	I531T	probably damaging	Het
Kng1	T	A	16: 23,079,678	H609Q	probably benign	Het
Mdn1	T	A	4: 32,746,446	S4131T	probably damaging	Het
Npnt	A	G	3: 132,948,128	S31P	probably damaging	Het
Olfr1098	T	A	2: 86,922,748	K261N	probably damaging	Het
Olfr1186	A	T	2: 88,525,646	Q21L	possibly damaging	Het
Olfr398	A	T	11: 73,984,295	F104L	possibly damaging	Het
Paxx	A	T	2: 25,460,226	L123Q	probably damaging	Het
Prdm13	C	T	4: 21,683,528	R144Q	unknown	Het
Rab2b	C	A	14: 52,279,345		probably benign	Het
Rnf207	A	G	4: 152,311,780	I509T	probably damaging	Het
Ropn1l	T	C	15: 31,453,509	Q12R		Het
Ryr3	T	G	2: 112,875,028	Y847S	probably damaging	Het
Slc1a6	A	T	10: 78,812,812	T456S	possibly damaging	Het
Slc5a9	T	C	4: 111,883,839	T537A	probably benign	Het
Slc9b2	T	C	3: 135,326,178	Y132H	unknown	Het
Sltm	T	C	9: 70,584,850	L725S	probably damaging	Het
Spz1	A	G	13: 92,575,927	C14R	probably benign	Het
Srrm4	T	A	5: 116,471,242	Q172L	unknown	Het
Synj2bp	T	C	12: 81,504,515	D92G	probably benign	Het
Tmem169	A	C	1: 72,301,070	T220P	probably benign	Het
Ttn	T	A	2: 76,888,028	I7270F	unknown	Het
Txndc16	T	G	14: 45,183,154	N137H	probably benign	Het
Ubr5	A	G	15: 37,976,145	Y2499H		Het
Ugt2b38	T	C	5: 87,410,446	D452G	probably damaging	Het
Zfp12	T	A	5: 143,245,502	I560N	possibly damaging	Het
Zfp60	A	G	7: 27,749,512	K535R	possibly damaging	Het
Zfp960	T	A	17: 17,088,499	C492S	probably damaging	Het

Other mutations in Slc26a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00418:Slc26a2	APN	18	61198740	missense	probably benign	0.05
IGL01570:Slc26a2	APN	18	61198260	missense	possibly damaging	0.80
IGL01800:Slc26a2	APN	18	61201729	nonsense	probably null
IGL02131:Slc26a2	APN	18	61198812	missense	possibly damaging	0.69
IGL02277:Slc26a2	APN	18	61198980	missense	probably damaging	1.00
IGL02438:Slc26a2	APN	18	61202217	missense	possibly damaging	0.46
IGL03338:Slc26a2	APN	18	61198902	missense	probably damaging	1.00
IGL03377:Slc26a2	APN	18	61198586	missense	probably damaging	1.00
R0029:Slc26a2	UTSW	18	61202310	missense	possibly damaging	0.73
R0531:Slc26a2	UTSW	18	61198379	missense	probably damaging	1.00
R1929:Slc26a2	UTSW	18	61198578	missense	possibly damaging	0.69
R2115:Slc26a2	UTSW	18	61198824	missense	possibly damaging	0.71
R2272:Slc26a2	UTSW	18	61198578	missense	possibly damaging	0.69
R2921:Slc26a2	UTSW	18	61201935	missense	probably damaging	0.99
R4184:Slc26a2	UTSW	18	61198832	missense	probably benign	0.01
R4765:Slc26a2	UTSW	18	61199486	missense	probably damaging	0.97
R4812:Slc26a2	UTSW	18	61202021	missense	probably damaging	1.00
R4948:Slc26a2	UTSW	18	61198258	nonsense	probably null
R4960:Slc26a2	UTSW	18	61198803	missense	probably damaging	1.00
R5107:Slc26a2	UTSW	18	61198560	missense	probably damaging	1.00
R6120:Slc26a2	UTSW	18	61199417	missense	possibly damaging	0.64
R6147:Slc26a2	UTSW	18	61201685	missense	probably damaging	1.00
R6914:Slc26a2	UTSW	18	61199279	missense	probably damaging	0.97
R6996:Slc26a2	UTSW	18	61201854	missense	probably damaging	1.00
R7529:Slc26a2	UTSW	18	61198358	missense	probably damaging	1.00
R7609:Slc26a2	UTSW	18	61198460	missense	probably benign	0.00
R7846:Slc26a2	UTSW	18	61198704	missense	probably benign	0.00
R8208:Slc26a2	UTSW	18	61198734	missense	probably damaging	1.00
X0003:Slc26a2	UTSW	18	61199195	missense	probably damaging	0.99
Z1177:Slc26a2	UTSW	18	61199537	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAAAACCTTGATGCCGGAC -3'
(R):5'- AAGAGTCAACAGGCTGCCAG -3'

Sequencing Primer
(F):5'- TGATGCCGGACTTGCTCC -3'
(R):5'- TGCCAGACGCAGCTGTCAG -3'

Posted On

2019-06-26