Mutagenetix > Incidental Mutations

Incidental Mutation 'R7166:Chfr'

557931

Institutional Source

Beutler Lab

Gene Symbol

Chfr

Ensembl Gene

ENSMUSG00000014668

Gene Name

checkpoint with forkhead and ring finger domains

Synonyms

RNF116, 5730484M20Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.215) question?

Stock #

R7166 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

110135842-110171972 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 110158805 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Glutamine at position 472 (P472Q)

Ref Sequence

ENSEMBL: ENSMUSP00000108138 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014812] [ENSMUST00000112519] [ENSMUST00000198066] [ENSMUST00000198633] [ENSMUST00000199557] [ENSMUST00000199672]

AlphaFold

Q810L3

Predicted Effect

probably benign
Transcript: ENSMUST00000014812
AA Change: P471Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000014812
Gene: ENSMUSG00000014668
AA Change: P471Q

Domain	Start	End	E-Value	Type
low complexity region	6	15	N/A	INTRINSIC
FHA	37	89	1.09e-6	SMART
low complexity region	203	215	N/A	INTRINSIC
RING	303	341	2.63e-4	SMART
low complexity region	396	421	N/A	INTRINSIC
RING	443	512	3.53e0	SMART
Blast:VWA	593	655	3e-12	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000112519
AA Change: P472Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000108138
Gene: ENSMUSG00000014668
AA Change: P472Q

Domain	Start	End	E-Value	Type
low complexity region	6	15	N/A	INTRINSIC
FHA	37	89	1.09e-6	SMART
low complexity region	203	215	N/A	INTRINSIC
RING	303	341	2.63e-4	SMART
low complexity region	396	421	N/A	INTRINSIC
RING	443	513	3.63e0	SMART
Blast:VWA	594	656	3e-12	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000198066

Predicted Effect

probably benign
Transcript: ENSMUST00000198633
AA Change: P400Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000143480
Gene: ENSMUSG00000014668
AA Change: P400Q

Domain	Start	End	E-Value	Type
low complexity region	6	15	N/A	INTRINSIC
FHA	37	89	1.09e-6	SMART
RING	231	269	2.63e-4	SMART
low complexity region	324	349	N/A	INTRINSIC
RING	371	441	3.63e0	SMART
Blast:VWA	522	584	2e-12	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000199557

SMART Domains

Protein: ENSMUSP00000143113
Gene: ENSMUSG00000014668

Domain	Start	End	E-Value	Type
SCOP:d1lgpa_	14	44	4e-5	SMART
PDB:1LGQ\|B	16	44	1e-10	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000199672

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (52/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an E3 ubiquitin-protein ligase required for the maintenance of the antephase checkpoint that regulates cell cycle entry into mitosis and, therefore, may play a key role in cell cycle progression and tumorigenesis. The encoded protein has an N-terminal forkhead-associated domain, a central RING-finger domain, and a cysteine-rich C-terminal region. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous null mice and MEFs display increased tumor incidence and inducibility, premature death, increased chromosomal instability, and cell cycle abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ambn	T	C	5: 88,467,528	L272P	possibly damaging	Het
Ash2l	C	A	8: 25,827,320	G335V	probably damaging	Het
Atp13a1	T	A	8: 69,799,316		probably null	Het
Atp13a2	G	A	4: 141,006,984	R1139Q	possibly damaging	Het
Atxn2	T	A	5: 121,796,397	N886K	possibly damaging	Het
Celsr3	G	T	9: 108,842,951	C2512F	probably damaging	Het
Cfap221	A	G	1: 119,948,113	V449A	probably benign	Het
Cfhr2	A	T	1: 139,831,101	C70*	probably null	Het
Crybg2	G	A	4: 134,060,882	R22Q	probably damaging	Het
Eef2k	T	C	7: 120,884,772	F244L	probably damaging	Het
Efcab11	A	T	12: 99,883,355	M23K		Het
Ercc8	T	A	13: 108,169,433	M114K	possibly damaging	Het
Fam217a	T	C	13: 34,910,315	Y487C	probably benign	Het
Farsb	T	C	1: 78,471,184	N205S	probably benign	Het
Glra1	A	G	11: 55,515,078	F370S	probably benign	Het
Gm12258	T	A	11: 58,858,473	M158K		Het
Gm14305	T	A	2: 176,720,943	H209Q	probably damaging	Het
Gm4924	A	T	10: 82,378,201	Q611L	unknown	Het
Gm5580	A	G	6: 116,551,368	I69V	probably benign	Het
Haus6	T	C	4: 86,583,687	E649G	possibly damaging	Het
Hist1h4j	A	G	13: 21,735,151	H19R	unknown	Het
Hlcs	C	T	16: 94,262,726	D345N	possibly damaging	Het
Htt	C	A	5: 34,852,894	Q1564K	probably benign	Het
Itpr1	G	A	6: 108,378,190	V481I	probably benign	Het
Jak3	T	C	8: 71,682,316	I531T	probably damaging	Het
Kng1	T	A	16: 23,079,678	H609Q	probably benign	Het
Mdn1	T	A	4: 32,746,446	S4131T	probably damaging	Het
Npnt	A	G	3: 132,948,128	S31P	probably damaging	Het
Olfr1098	T	A	2: 86,922,748	K261N	probably damaging	Het
Olfr1186	A	T	2: 88,525,646	Q21L	possibly damaging	Het
Olfr398	A	T	11: 73,984,295	F104L	possibly damaging	Het
Paxx	A	T	2: 25,460,226	L123Q	probably damaging	Het
Prdm13	C	T	4: 21,683,528	R144Q	unknown	Het
Rab2b	C	A	14: 52,279,345		probably benign	Het
Rnf207	A	G	4: 152,311,780	I509T	probably damaging	Het
Ropn1l	T	C	15: 31,453,509	Q12R		Het
Ryr3	T	G	2: 112,875,028	Y847S	probably damaging	Het
Slc1a6	A	T	10: 78,812,812	T456S	possibly damaging	Het
Slc26a2	A	T	18: 61,198,829	M510K	possibly damaging	Het
Slc5a9	T	C	4: 111,883,839	T537A	probably benign	Het
Slc9b2	T	C	3: 135,326,178	Y132H	unknown	Het
Sltm	T	C	9: 70,584,850	L725S	probably damaging	Het
Spz1	A	G	13: 92,575,927	C14R	probably benign	Het
Srrm4	T	A	5: 116,471,242	Q172L	unknown	Het
Synj2bp	T	C	12: 81,504,515	D92G	probably benign	Het
Tmem169	A	C	1: 72,301,070	T220P	probably benign	Het
Ttn	T	A	2: 76,888,028	I7270F	unknown	Het
Txndc16	T	G	14: 45,183,154	N137H	probably benign	Het
Ubr5	A	G	15: 37,976,145	Y2499H		Het
Ugt2b38	T	C	5: 87,410,446	D452G	probably damaging	Het
Zfp12	T	A	5: 143,245,502	I560N	possibly damaging	Het
Zfp60	A	G	7: 27,749,512	K535R	possibly damaging	Het
Zfp960	T	A	17: 17,088,499	C492S	probably damaging	Het

Other mutations in Chfr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01333:Chfr	APN	5	110143573	missense	possibly damaging	0.94
IGL01479:Chfr	APN	5	110144993	unclassified	probably benign
IGL02543:Chfr	APN	5	110143547	splice site	probably null
IGL02657:Chfr	APN	5	110154839	missense	probably damaging	1.00
IGL03057:Chfr	APN	5	110143609	missense	probably benign	0.14
PIT4445001:Chfr	UTSW	5	110151677	missense	possibly damaging	0.88
R0938:Chfr	UTSW	5	110164058	missense	probably damaging	1.00
R1346:Chfr	UTSW	5	110140447	missense	probably damaging	1.00
R1561:Chfr	UTSW	5	110158808	missense	probably benign	0.05
R1602:Chfr	UTSW	5	110151665	missense	probably benign	0.26
R1658:Chfr	UTSW	5	110153169	missense	probably damaging	1.00
R2134:Chfr	UTSW	5	110144761	splice site	probably null
R2234:Chfr	UTSW	5	110170863	missense	probably damaging	1.00
R4371:Chfr	UTSW	5	110136168	missense	probably damaging	0.99
R4420:Chfr	UTSW	5	110170880	nonsense	probably null
R4666:Chfr	UTSW	5	110144867	nonsense	probably null
R4742:Chfr	UTSW	5	110143598	missense	probably benign	0.04
R4809:Chfr	UTSW	5	110158834	missense	probably damaging	1.00
R5490:Chfr	UTSW	5	110153129	missense	possibly damaging	0.88
R5581:Chfr	UTSW	5	110153282	critical splice donor site	probably null
R5820:Chfr	UTSW	5	110162739	missense	possibly damaging	0.94
R6012:Chfr	UTSW	5	110144651	critical splice donor site	probably null
R7128:Chfr	UTSW	5	110143636	missense	probably benign	0.33
R7278:Chfr	UTSW	5	110140360	missense	probably benign	0.23
R7393:Chfr	UTSW	5	110152358	missense	probably damaging	0.98
R7422:Chfr	UTSW	5	110162705	splice site	probably null
R7499:Chfr	UTSW	5	110151683	missense	probably benign	0.40
R8224:Chfr	UTSW	5	110160243	critical splice donor site	probably null
R8264:Chfr	UTSW	5	110152434	missense	possibly damaging	0.86
R8325:Chfr	UTSW	5	110162763	nonsense	probably null
R8333:Chfr	UTSW	5	110154937	missense	probably benign	0.05
R8823:Chfr	UTSW	5	110152392	missense	probably damaging	0.96
R9024:Chfr	UTSW	5	110158832	missense	probably benign	0.26
R9419:Chfr	UTSW	5	110169190	missense	probably damaging	1.00
X0013:Chfr	UTSW	5	110151579	missense	probably benign	0.19
Z1176:Chfr	UTSW	5	110144895	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGCTGGCCTGAATTCTTGTG -3'
(R):5'- AGAAGAGCTCCATGTGTGTTGC -3'

Sequencing Primer
(F):5'- GCCTGAATTCTTGTGTTTCAAATAGC -3'
(R):5'- GTTTTGCAGCACTAGGAATGAAACC -3'

Posted On

2019-06-26