Incidental Mutation 'R7196:Olfr310'
ID559924
Institutional Source Beutler Lab
Gene Symbol Olfr310
Ensembl Gene ENSMUSG00000057540
Gene Nameolfactory receptor 310
SynonymsGA_x6K02T2NHDJ-9838699-9839697, MOR227-6P
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R7196 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location86268487-86277172 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86269441 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 116 (M116K)
Ref Sequence ENSEMBL: ENSMUSP00000151989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081918] [ENSMUST00000217724]
Predicted Effect probably damaging
Transcript: ENSMUST00000081918
AA Change: M116K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080589
Gene: ENSMUSG00000057540
AA Change: M116K

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 8.9e-46 PFAM
Pfam:7tm_1 39 289 1.8e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217724
AA Change: M116K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency 99% (94/95)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik AGCTTCCCTGCTT AGCTT 9: 57,258,222 probably null Het
4921504E06Rik A C 2: 19,493,995 S396A probably benign Het
Actr6 C A 10: 89,714,922 V337F possibly damaging Het
Agtpbp1 T C 13: 59,533,180 T73A possibly damaging Het
AI182371 A T 2: 35,086,429 probably null Het
Apob A G 12: 7,983,893 E202G possibly damaging Het
Asb4 A T 6: 5,423,356 M168L probably benign Het
AU018091 T C 7: 3,163,958 Y152C probably damaging Het
Casp3 G A 8: 46,635,463 G132R possibly damaging Het
Cbfa2t3 C A 8: 122,638,990 A229S probably benign Het
Cdh23 A T 10: 60,307,980 Y2949N probably damaging Het
Ceacam3 T C 7: 17,154,956 Y217H Het
Cldn5 A T 16: 18,776,880 probably benign Het
Cltc T C 11: 86,706,831 D1093G probably damaging Het
Cnn3 G A 3: 121,454,788 probably null Het
Col4a2 A G 8: 11,398,693 Y71C probably damaging Het
Csf1 T C 3: 107,753,898 D77G possibly damaging Het
Cyp2j7 T A 4: 96,215,414 T295S probably benign Het
Dnah7a A T 1: 53,684,841 M133K probably benign Het
Dock5 G A 14: 67,756,470 P1852L probably damaging Het
Dpysl3 T A 18: 43,329,845 D489V probably damaging Het
Dsg4 T C 18: 20,466,480 Y718H probably damaging Het
Dync2h1 G A 9: 7,147,715 Q972* probably null Het
Epn1 G A 7: 5,093,381 D225N possibly damaging Het
Esp4 A G 17: 40,602,365 E41G probably benign Het
Fam171a2 T C 11: 102,438,346 D529G probably benign Het
Fbxl13 A T 5: 21,486,303 I694N probably damaging Het
Fshr C T 17: 88,985,469 A594T probably damaging Het
Galnt3 A G 2: 66,090,924 Y533H probably damaging Het
Gja5 C A 3: 97,051,106 R160S probably damaging Het
Gm12353 A T 4: 19,608,938 D7V unknown Het
Gm17669 T C 18: 67,562,502 F39S probably damaging Het
Gm7145 T A 1: 117,986,061 N224K possibly damaging Het
Gpd1 G T 15: 99,722,055 G245C probably benign Het
Gpr4 G A 7: 19,223,164 G337D probably benign Het
Hgd G A 16: 37,588,716 C14Y probably benign Het
Ibtk A T 9: 85,743,656 S14T probably damaging Het
Ifi205 G T 1: 174,026,543 N181K probably damaging Het
Inppl1 G A 7: 101,828,786 A673V probably benign Het
Itgb3 C A 11: 104,633,612 Y191* probably null Het
Jrkl G T 9: 13,244,157 P500T probably benign Het
Kcnq1 G A 7: 143,358,741 V515I possibly damaging Het
Kifc3 A G 8: 95,106,611 V453A probably benign Het
Krt10 C T 11: 99,387,545 E263K probably damaging Het
Lingo1 A T 9: 56,620,619 F235I probably damaging Het
Lmo7 T A 14: 101,896,500 D660E possibly damaging Het
Magi3 A C 3: 104,049,168 C661W probably benign Het
Mmp1a C T 9: 7,476,017 Q428* probably null Het
Msrb1 A T 17: 24,739,582 T47S probably benign Het
Naip6 A T 13: 100,300,158 I619K probably benign Het
Ndfip2 T C 14: 105,298,038 S253P probably damaging Het
Nebl A T 2: 17,452,518 V77E probably damaging Het
Nit1 T C 1: 171,344,435 E65G probably benign Het
Ntn4 C T 10: 93,733,714 H430Y probably benign Het
Nxpe5 A T 5: 138,239,324 I49F probably benign Het
Olfr1299 T G 2: 111,664,697 L157W probably damaging Het
Olfr18 A G 9: 20,314,198 Y241H probably benign Het
Olfr24 A T 9: 18,755,590 L15* probably null Het
Olfr382 A G 11: 73,517,131 Y23H probably benign Het
Olfr605 A T 7: 103,442,997 M42K probably benign Het
Olfr714 A G 7: 107,074,728 N300S probably benign Het
Olfr95 A G 17: 37,211,193 I220T probably damaging Het
Oxct2a T A 4: 123,323,372 N72I probably damaging Het
Pappa G A 4: 65,323,891 probably null Het
Pcnx G A 12: 81,995,538 R34H possibly damaging Het
Plekha5 G T 6: 140,543,922 V236L possibly damaging Het
Prdm1 A G 10: 44,456,992 S44P probably benign Het
Prss46 T A 9: 110,851,465 L226Q probably benign Het
Prss47 C A 13: 65,044,826 W380C probably benign Het
Ptch2 T G 4: 117,114,749 V1156G probably benign Het
Rab3gap2 T C 1: 185,281,667 F1190S probably damaging Het
Raver2 T G 4: 101,102,859 Y179D probably damaging Het
Rgl2 C T 17: 33,933,429 R367W probably damaging Het
Ripor2 T G 13: 24,704,825 I629S possibly damaging Het
Robo4 T A 9: 37,402,705 M84K possibly damaging Het
Rps6ka5 A T 12: 100,595,864 S252T possibly damaging Het
Rtl1 C T 12: 109,592,787 V873M possibly damaging Het
Sla T A 15: 66,831,571 R4W probably benign Het
Smco1 A G 16: 32,273,802 D97G probably damaging Het
Srgap1 T C 10: 121,840,848 T414A probably benign Het
Syt14 A G 1: 193,035,628 I3T probably benign Het
Tnpo2 G A 8: 85,047,137 V303M possibly damaging Het
Tstd2 A C 4: 46,119,955 S332R probably damaging Het
Ttn C A 2: 76,752,042 A22836S possibly damaging Het
Ufl1 A G 4: 25,250,669 V728A probably benign Het
Usp33 A T 3: 152,384,191 K789N possibly damaging Het
Usp54 T A 14: 20,588,370 Q214L probably damaging Het
Vmn2r7 T G 3: 64,715,777 N374T probably benign Het
Zbtb7a T A 10: 81,144,600 N209K probably damaging Het
Zc3hav1 A G 6: 38,329,272 V615A probably benign Het
Zdhhc20 A G 14: 57,873,891 probably null Het
Zfp90 G T 8: 106,425,148 V498L probably damaging Het
Other mutations in Olfr310
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Olfr310 APN 7 86269669 missense probably damaging 1.00
IGL00917:Olfr310 APN 7 86269441 missense probably damaging 1.00
IGL02145:Olfr310 APN 7 86269258 missense probably damaging 1.00
IGL02639:Olfr310 APN 7 86269720 missense probably damaging 0.99
R0139:Olfr310 UTSW 7 86268979 missense probably benign 0.00
R0554:Olfr310 UTSW 7 86269657 missense probably damaging 0.99
R1392:Olfr310 UTSW 7 86268855 missense probably benign 0.01
R1392:Olfr310 UTSW 7 86268855 missense probably benign 0.01
R1474:Olfr310 UTSW 7 86269062 missense probably damaging 1.00
R2379:Olfr310 UTSW 7 86269649 missense probably damaging 1.00
R3692:Olfr310 UTSW 7 86269495 missense probably damaging 1.00
R4290:Olfr310 UTSW 7 86269760 missense probably damaging 1.00
R4291:Olfr310 UTSW 7 86269760 missense probably damaging 1.00
R4295:Olfr310 UTSW 7 86269760 missense probably damaging 1.00
R5071:Olfr310 UTSW 7 86269591 missense probably damaging 0.99
R5072:Olfr310 UTSW 7 86269591 missense probably damaging 0.99
R5074:Olfr310 UTSW 7 86269591 missense probably damaging 0.99
R5828:Olfr310 UTSW 7 86269520 missense probably benign 0.00
R6174:Olfr310 UTSW 7 86268801 missense probably benign
R6207:Olfr310 UTSW 7 86269760 missense probably damaging 1.00
R6493:Olfr310 UTSW 7 86268882 missense probably benign 0.21
R7068:Olfr310 UTSW 7 86269537 missense probably damaging 1.00
R7694:Olfr310 UTSW 7 86269775 missense probably damaging 1.00
R7794:Olfr310 UTSW 7 86269133 missense probably damaging 0.99
Z1176:Olfr310 UTSW 7 86268947 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCAGCAAAGCAGGAAGATC -3'
(R):5'- ACTACAGTTGACCAGACCCTG -3'

Sequencing Primer
(F):5'- GAAGAACTGAGGGACCACATTAG -3'
(R):5'- GTTGACCAGACCCTGAACAC -3'
Posted On2019-06-26