Incidental Mutation 'R2379:Olfr310'
ID248382
Institutional Source Beutler Lab
Gene Symbol Olfr310
Ensembl Gene ENSMUSG00000057540
Gene Nameolfactory receptor 310
SynonymsGA_x6K02T2NHDJ-9838699-9839697, MOR227-6P
MMRRC Submission 040355-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R2379 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location86268487-86277172 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86269649 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 47 (T47A)
Ref Sequence ENSEMBL: ENSMUSP00000151989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081918] [ENSMUST00000217724]
Predicted Effect probably damaging
Transcript: ENSMUST00000081918
AA Change: T47A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080589
Gene: ENSMUSG00000057540
AA Change: T47A

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 8.9e-46 PFAM
Pfam:7tm_1 39 289 1.8e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217724
AA Change: T47A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.4106 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 93.3%
Validation Efficiency 93% (37/40)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik A T 7: 140,299,769 D990V probably benign Het
9930021J03Rik G T 19: 29,718,875 Q1140K probably benign Het
Aff4 T C 11: 53,408,478 probably benign Het
Anpep T C 7: 79,841,218 T209A probably benign Het
Asb16 A G 11: 102,272,531 T116A probably benign Het
Btc A T 5: 91,376,909 probably benign Het
C4b T C 17: 34,735,743 D860G possibly damaging Het
Cd177 G A 7: 24,758,043 T191I possibly damaging Het
Cngb1 A G 8: 95,260,130 L378P probably damaging Het
Ddx60 T C 8: 62,037,088 F1697S probably damaging Het
Dopey1 G A 9: 86,521,085 S1446N probably damaging Het
Fn1 T A 1: 71,649,284 K154* probably null Het
Gm10801 G T 2: 98,663,840 S109I probably benign Het
Ifi204 T A 1: 173,755,993 R220* probably null Het
Limk1 A G 5: 134,679,481 probably benign Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mms22l T A 4: 24,496,929 S8T possibly damaging Het
Mpp7 T A 18: 7,403,345 R322* probably null Het
Mycbp2 T C 14: 103,174,950 N2529S probably benign Het
Npr3 A G 15: 11,883,363 F327L probably damaging Het
Olfr295 T G 7: 86,586,192 F306V probably benign Het
Olfr491 T C 7: 108,317,292 S133P probably benign Het
Olfr530 A T 7: 140,372,835 Y258* probably null Het
Olfr561 A T 7: 102,774,845 H107L probably benign Het
Olfr815 A T 10: 129,901,912 V266E probably damaging Het
Olfr873 T C 9: 20,300,667 S157P possibly damaging Het
Pld2 A T 11: 70,554,314 Y580F probably benign Het
Sik3 A G 9: 46,155,409 E162G probably damaging Het
Sla2 G A 2: 156,875,942 R137C probably damaging Het
Spen T C 4: 141,516,927 T266A unknown Het
Tnks1bp1 A G 2: 85,063,838 S1370G probably benign Het
Usp28 A G 9: 49,003,095 R99G probably null Het
Vmn2r13 T G 5: 109,171,778 E445D probably benign Het
Vmn2r27 A G 6: 124,224,383 I205T possibly damaging Het
Other mutations in Olfr310
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Olfr310 APN 7 86269669 missense probably damaging 1.00
IGL00917:Olfr310 APN 7 86269441 missense probably damaging 1.00
IGL02145:Olfr310 APN 7 86269258 missense probably damaging 1.00
IGL02639:Olfr310 APN 7 86269720 missense probably damaging 0.99
R0139:Olfr310 UTSW 7 86268979 missense probably benign 0.00
R0554:Olfr310 UTSW 7 86269657 missense probably damaging 0.99
R1392:Olfr310 UTSW 7 86268855 missense probably benign 0.01
R1392:Olfr310 UTSW 7 86268855 missense probably benign 0.01
R1474:Olfr310 UTSW 7 86269062 missense probably damaging 1.00
R3692:Olfr310 UTSW 7 86269495 missense probably damaging 1.00
R4290:Olfr310 UTSW 7 86269760 missense probably damaging 1.00
R4291:Olfr310 UTSW 7 86269760 missense probably damaging 1.00
R4295:Olfr310 UTSW 7 86269760 missense probably damaging 1.00
R5071:Olfr310 UTSW 7 86269591 missense probably damaging 0.99
R5072:Olfr310 UTSW 7 86269591 missense probably damaging 0.99
R5074:Olfr310 UTSW 7 86269591 missense probably damaging 0.99
R5828:Olfr310 UTSW 7 86269520 missense probably benign 0.00
R6174:Olfr310 UTSW 7 86268801 missense probably benign
R6207:Olfr310 UTSW 7 86269760 missense probably damaging 1.00
R6493:Olfr310 UTSW 7 86268882 missense probably benign 0.21
R7068:Olfr310 UTSW 7 86269537 missense probably damaging 1.00
R7196:Olfr310 UTSW 7 86269441 missense probably damaging 1.00
R7694:Olfr310 UTSW 7 86269775 missense probably damaging 1.00
R7794:Olfr310 UTSW 7 86269133 missense probably damaging 0.99
Z1176:Olfr310 UTSW 7 86268947 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCAGATGGCCACATAGCG -3'
(R):5'- CTCTGTGTATTACAAGGTAACCATG -3'

Sequencing Primer
(F):5'- AGATGGCCACATAGCGGTCTTG -3'
(R):5'- TGGGAGCTCAGGATCTTA -3'
Posted On2014-11-11