Incidental Mutation 'R7262:Pam'
ID564671
Institutional Source Beutler Lab
Gene Symbol Pam
Ensembl Gene ENSMUSG00000026335
Gene Namepeptidylglycine alpha-amidating monooxygenase
SynonymsPHM
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7262 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location97795114-98095646 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97854723 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 157 (K157R)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058762] [ENSMUST00000097625] [ENSMUST00000161567]
Predicted Effect probably benign
Transcript: ENSMUST00000058762
SMART Domains Protein: ENSMUSP00000057112
Gene: ENSMUSG00000026335

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Cu2_monooxygen 62 178 7.8e-27 PFAM
Pfam:Cu2_monoox_C 199 346 6.2e-47 PFAM
Pfam:NHL 633 662 2.1e-8 PFAM
low complexity region 673 680 N/A INTRINSIC
Pfam:NHL 686 714 2.7e-8 PFAM
Pfam:NHL 782 809 2.8e-7 PFAM
transmembrane domain 870 892 N/A INTRINSIC
low complexity region 908 930 N/A INTRINSIC
low complexity region 950 969 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097625
SMART Domains Protein: ENSMUSP00000095228
Gene: ENSMUSG00000026335

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Cu2_monooxygen 60 183 3.7e-34 PFAM
Pfam:Cu2_monoox_C 198 349 1.4e-54 PFAM
Pfam:NHL 581 608 9.4e-9 PFAM
Pfam:NHL 633 662 2.1e-8 PFAM
low complexity region 673 680 N/A INTRINSIC
Pfam:NHL 686 714 2.2e-8 PFAM
Pfam:NHL 782 809 3.6e-8 PFAM
transmembrane domain 869 891 N/A INTRINSIC
low complexity region 907 929 N/A INTRINSIC
low complexity region 949 968 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000124479
Gene: ENSMUSG00000026335
AA Change: K157R

DomainStartEndE-ValueType
Pfam:Cu2_monoox_C 1 53 4.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161567
SMART Domains Protein: ENSMUSP00000125418
Gene: ENSMUSG00000026335

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Cu2_monooxygen 60 183 3.2e-34 PFAM
Pfam:Cu2_monoox_C 198 349 1.2e-54 PFAM
Pfam:NHL 475 502 8.3e-9 PFAM
Pfam:NHL 527 556 1.9e-8 PFAM
low complexity region 567 574 N/A INTRINSIC
Pfam:NHL 580 608 1.9e-8 PFAM
Pfam:NHL 676 703 3.2e-8 PFAM
transmembrane domain 764 786 N/A INTRINSIC
low complexity region 802 824 N/A INTRINSIC
low complexity region 844 863 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multifunctional protein. The encoded preproprotein is proteolytically processed to generate the mature enzyme. This enzyme includes two domains with distinct catalytic activities, a peptidylglycine alpha-hydroxylating monooxygenase (PHM) domain and a peptidyl-alpha-hydroxyglycine alpha-amidating lyase (PAL) domain. These catalytic domains work sequentially to catalyze the conversion of neuroendocrine peptides to active alpha-amidated products. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality during fetal growth and development, edema, abnormal yolk sac vasculature, thin arterial walls, and abnormal bronchial epithelial morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik G A 17: 33,066,997 T277I probably damaging Het
Acap2 A G 16: 31,127,319 probably null Het
Adh5 C A 3: 138,445,372 A32D possibly damaging Het
Ap1m2 A G 9: 21,302,466 I295T possibly damaging Het
B230104I21Rik T C 4: 154,349,634 S92P unknown Het
Carnmt1 A T 19: 18,677,864 N127I probably benign Het
Ccdc42 A G 11: 68,594,573 T106A probably damaging Het
Cdcp1 T C 9: 123,173,615 E797G probably damaging Het
Cep112 T A 11: 108,664,641 V821D probably damaging Het
Cpvl A T 6: 53,932,515 V212D probably damaging Het
Cttnbp2nl A T 3: 105,032,746 N2K probably damaging Het
Cyp2c69 T C 19: 39,886,732 probably benign Het
Cyp2u1 T C 3: 131,297,956 D305G probably damaging Het
Dab2ip A G 2: 35,622,286 probably null Het
Ddx55 T C 5: 124,566,856 L396P probably benign Het
Dhx34 G A 7: 16,203,698 A786V probably benign Het
Ehbp1l1 A T 19: 5,718,446 L943* probably null Het
Epm2aip1 A G 9: 111,272,660 T234A probably benign Het
Flot2 T C 11: 78,057,349 M145T probably damaging Het
Fn3k T C 11: 121,448,915 F168L probably damaging Het
Gm11639 G A 11: 104,854,606 probably null Het
Gmfb A T 14: 46,814,929 C87S probably damaging Het
H2-M3 T C 17: 37,271,193 F180S probably damaging Het
Havcr2 C T 11: 46,469,561 T205I probably benign Het
Hdac3 C T 18: 37,945,563 C123Y probably damaging Het
Itpk1 T C 12: 102,675,453 E37G possibly damaging Het
Jmjd7 A G 2: 120,031,986 H283R probably benign Het
Kif26b T C 1: 178,917,654 S1772P possibly damaging Het
Klhl6 T C 16: 19,982,796 T70A probably damaging Het
Kntc1 C A 5: 123,786,973 D1116E probably benign Het
Lama4 T A 10: 39,094,934 H1498Q probably damaging Het
Lamp1 A T 8: 13,167,296 T102S probably benign Het
Lrp8 A G 4: 107,847,464 N168D probably benign Het
Ltbp1 G T 17: 75,364,368 D1515Y probably damaging Het
Obscn A G 11: 59,115,889 V1149A probably damaging Het
Olfr1310 A G 2: 112,008,557 S210P probably damaging Het
Olfr1494 A T 19: 13,749,171 T22S probably benign Het
Olfr600 T C 7: 103,346,557 R124G probably damaging Het
Pak4 C A 7: 28,565,200 M92I possibly damaging Het
Pcdh9 A T 14: 93,015,705 V1174E probably benign Het
Ppp1r3a T C 6: 14,719,070 D615G probably benign Het
Senp1 A T 15: 98,066,498 D278E probably benign Het
Serpinc1 A G 1: 160,989,659 N108D probably damaging Het
Srl C A 16: 4,497,551 A76S probably damaging Het
Tbc1d16 C A 11: 119,155,095 V509L probably benign Het
Tbc1d24 A G 17: 24,207,846 F357S probably damaging Het
Tcaf3 A G 6: 42,593,801 L339P probably damaging Het
Tmem232 A T 17: 65,500,117 I27N probably benign Het
Ubr2 T C 17: 47,000,739 D62G probably damaging Het
Vcan T G 13: 89,705,161 D560A possibly damaging Het
Vmn2r80 T A 10: 79,169,745 N405K probably damaging Het
Wdhd1 A T 14: 47,251,973 I701K probably benign Het
Other mutations in Pam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Pam APN 1 97924427 splice site probably benign
IGL00485:Pam APN 1 97822953 missense possibly damaging 0.78
IGL00597:Pam APN 1 97834444 missense probably benign 0.02
IGL01585:Pam APN 1 97864472 missense probably damaging 0.99
IGL01776:Pam APN 1 97885600 critical splice donor site probably null
IGL01981:Pam APN 1 97834441 missense probably damaging 1.00
IGL02152:Pam APN 1 97840749 missense probably damaging 1.00
IGL02605:Pam APN 1 97840339 missense possibly damaging 0.85
IGL02882:Pam APN 1 97840367 missense probably damaging 1.00
IGL03142:Pam APN 1 97894386 missense probably damaging 1.00
IGL03409:Pam APN 1 97864329 missense probably benign 0.04
R0084:Pam UTSW 1 97896049 missense probably benign 0.01
R0200:Pam UTSW 1 97894401 splice site probably null
R0520:Pam UTSW 1 97884195 missense probably benign 0.00
R0734:Pam UTSW 1 97864362 nonsense probably null
R1881:Pam UTSW 1 97923151 missense probably benign 0.06
R2040:Pam UTSW 1 97864442 missense possibly damaging 0.55
R2106:Pam UTSW 1 97831490 missense probably damaging 1.00
R2913:Pam UTSW 1 97923129 missense probably damaging 1.00
R3148:Pam UTSW 1 97895678 missense possibly damaging 0.84
R3618:Pam UTSW 1 97834432 missense probably damaging 1.00
R3619:Pam UTSW 1 97834432 missense probably damaging 1.00
R3847:Pam UTSW 1 97854756 intron probably benign
R3848:Pam UTSW 1 97854756 intron probably benign
R3849:Pam UTSW 1 97854756 intron probably benign
R4128:Pam UTSW 1 97834468 missense probably damaging 0.99
R4231:Pam UTSW 1 97884124 critical splice donor site probably null
R4233:Pam UTSW 1 97864394 missense possibly damaging 0.86
R4404:Pam UTSW 1 97854721 intron probably benign
R4536:Pam UTSW 1 97844699 nonsense probably null
R4738:Pam UTSW 1 97923132 missense probably damaging 1.00
R5054:Pam UTSW 1 97821917 missense probably damaging 1.00
R5501:Pam UTSW 1 97840365 nonsense probably null
R5572:Pam UTSW 1 97854744 intron probably benign
R5654:Pam UTSW 1 97864398 missense probably benign 0.00
R5659:Pam UTSW 1 97842299 missense probably damaging 1.00
R6112:Pam UTSW 1 97834468 missense probably damaging 0.99
R6513:Pam UTSW 1 97838027 missense possibly damaging 0.60
R6696:Pam UTSW 1 97885727 missense possibly damaging 0.79
R6743:Pam UTSW 1 97896049 missense probably benign 0.01
R6833:Pam UTSW 1 97837992 missense probably damaging 0.99
R6834:Pam UTSW 1 97837992 missense probably damaging 0.99
R7098:Pam UTSW 1 97898347 missense probably benign
R7117:Pam UTSW 1 97977116 start gained probably benign
R7152:Pam UTSW 1 97885740 missense probably damaging 1.00
R7172:Pam UTSW 1 97834478 missense probably benign 0.10
R7206:Pam UTSW 1 97896032 missense probably damaging 1.00
R7434:Pam UTSW 1 97975790 nonsense probably null
R7466:Pam UTSW 1 97842247 missense probably damaging 1.00
R7513:Pam UTSW 1 97853185 missense possibly damaging 0.88
R7790:Pam UTSW 1 97821847 missense probably damaging 1.00
R8054:Pam UTSW 1 97840389 missense probably damaging 1.00
R8093:Pam UTSW 1 97885632 missense probably damaging 1.00
R8183:Pam UTSW 1 97834474 missense probably benign 0.08
R8404:Pam UTSW 1 97895633 missense probably damaging 1.00
Z1176:Pam UTSW 1 97934723 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGTTATGTAAAGGCCCCTGTCC -3'
(R):5'- GCTCACCCATTCTTAACTTGAAAC -3'

Sequencing Primer
(F):5'- GGCCCCTGTCCATGAAAATC -3'
(R):5'- CCATTTCTAGGTGAGCTTCTGAAGAG -3'
Posted On2019-06-26