Incidental Mutation 'R0583:Ribc2'
ID56531
Institutional Source Beutler Lab
Gene Symbol Ribc2
Ensembl Gene ENSMUSG00000022431
Gene NameRIB43A domain with coiled-coils 2
SynonymsTrib, 4930579A10Rik
MMRRC Submission 038773-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R0583 (G1)
Quality Score175
Status Not validated
Chromosome15
Chromosomal Location85132078-85144570 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 85132914 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000023068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023067] [ENSMUST00000023068] [ENSMUST00000229238]
Predicted Effect probably damaging
Transcript: ENSMUST00000023067
AA Change: Q51L

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000023067
Gene: ENSMUSG00000022431
AA Change: Q51L

DomainStartEndE-ValueType
Pfam:RIB43A 3 377 9.7e-147 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000023068
SMART Domains Protein: ENSMUSP00000023068
Gene: ENSMUSG00000022432

DomainStartEndE-ValueType
Pfam:AAA_23 7 361 2e-10 PFAM
Pfam:AAA_21 27 372 7.2e-9 PFAM
low complexity region 422 437 N/A INTRINSIC
SMC_hinge 513 629 1.5e-23 SMART
PDB:1W1W|D 1046 1218 3e-42 PDB
Blast:AAA 1063 1217 5e-25 BLAST
SCOP:d1e69a_ 1114 1202 3e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000229238
AA Change: Q51L

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.1%
  • 20x: 93.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A G 9: 57,257,643 S483P probably benign Het
2700081O15Rik A G 19: 7,420,274 D62G probably damaging Het
5730480H06Rik A G 5: 48,380,128 H169R probably damaging Het
Actn1 T A 12: 80,199,029 I127F probably damaging Het
AW822073 G A 10: 58,223,388 L515F probably damaging Het
Cadm3 T G 1: 173,341,171 T277P probably benign Het
Cast T C 13: 74,713,678 T629A probably damaging Het
Cblc C A 7: 19,792,561 C201F probably benign Het
Ccdc154 T A 17: 25,168,424 D375E possibly damaging Het
Cdk6 A G 5: 3,473,183 D201G probably damaging Het
Cep95 T C 11: 106,814,623 V478A probably benign Het
Ciita T C 16: 10,523,804 probably null Het
Clec4e A G 6: 123,283,694 F135S probably damaging Het
Cntn6 A G 6: 104,776,314 D337G possibly damaging Het
Crlf3 A T 11: 80,059,281 H174Q probably damaging Het
Cyb5r1 T A 1: 134,407,601 F93I probably damaging Het
Dopey2 T C 16: 93,755,486 I271T probably benign Het
Fcho1 T C 8: 71,715,725 Y218C probably damaging Het
Fhad1 C T 4: 141,903,990 M1297I probably benign Het
Igdcc4 T C 9: 65,121,813 V244A possibly damaging Het
Ikzf5 A G 7: 131,391,785 probably null Het
Ilvbl T A 10: 78,583,267 V450E probably damaging Het
Kcns3 T G 12: 11,091,478 N407H probably damaging Het
Klhl11 T C 11: 100,464,324 K224E possibly damaging Het
Klra17 T A 6: 129,868,693 D186V probably damaging Het
Lrrc37a T C 11: 103,498,437 D2054G probably benign Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Mrgbp A G 2: 180,584,446 N104S probably benign Het
Mroh2a GT GTT 1: 88,256,166 probably null Het
Muc5ac C A 7: 141,807,608 T1552N probably damaging Het
Muc5b T A 7: 141,856,698 Y1269* probably null Het
Myef2 T C 2: 125,097,981 probably null Het
Myg1 C T 15: 102,337,790 Q367* probably null Het
Nalcn T C 14: 123,294,343 N1365S possibly damaging Het
Nfu1 T C 6: 87,009,952 C18R probably benign Het
Nkx2-6 A T 14: 69,174,779 Q132L probably damaging Het
Olfr1085 T A 2: 86,658,360 I33F probably benign Het
Olfr516 C T 7: 108,845,414 A199T possibly damaging Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Prh1 A T 6: 132,571,833 Q101L unknown Het
Rnf19a C A 15: 36,253,005 R396L probably damaging Het
Sdad1 A G 5: 92,305,064 I105T probably damaging Het
Sec24b G T 3: 130,041,311 Y79* probably null Het
Tatdn2 A G 6: 113,702,525 E277G possibly damaging Het
Tex10 A C 4: 48,451,952 F725V probably damaging Het
Themis3 T C 17: 66,559,753 D164G probably benign Het
Ubxn7 T C 16: 32,375,914 W220R probably damaging Het
Usp33 C A 3: 152,368,254 R246S probably damaging Het
Vmn2r102 T A 17: 19,676,781 V130E probably benign Het
Vmn2r112 C T 17: 22,618,949 P797L probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Yme1l1 T C 2: 23,186,250 V340A probably damaging Het
Other mutations in Ribc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02028:Ribc2 APN 15 85143335 missense possibly damaging 0.95
IGL02816:Ribc2 APN 15 85132905 missense probably damaging 0.99
IGL02830:Ribc2 APN 15 85132257 utr 5 prime probably benign
IGL03336:Ribc2 APN 15 85132913 nonsense probably null
IGL03350:Ribc2 APN 15 85135502 missense probably damaging 1.00
R3685:Ribc2 UTSW 15 85135334 missense possibly damaging 0.89
R3943:Ribc2 UTSW 15 85135250 missense probably benign 0.00
R3944:Ribc2 UTSW 15 85135250 missense probably benign 0.00
R4758:Ribc2 UTSW 15 85141666 missense probably damaging 1.00
R7234:Ribc2 UTSW 15 85135532 missense probably benign 0.00
R7472:Ribc2 UTSW 15 85135245 missense probably benign 0.33
R7567:Ribc2 UTSW 15 85143247 missense probably damaging 0.98
R7653:Ribc2 UTSW 15 85141675 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- CAAAGGCTTCCACGTATGGGAAGG -3'
(R):5'- TGCTCCAGCACACAAGTGTCAC -3'

Sequencing Primer
(F):5'- GAAGGGAACCTTTAATGCTGTG -3'
(R):5'- tgggaggcagaggcagg -3'
Posted On2013-07-11