Incidental Mutation 'R0583:Sdad1'
ID56501
Institutional Source Beutler Lab
Gene Symbol Sdad1
Ensembl Gene ENSMUSG00000029415
Gene NameSDA1 domain containing 1
Synonyms
MMRRC Submission 038773-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.960) question?
Stock #R0583 (G1)
Quality Score192
Status Not validated
Chromosome5
Chromosomal Location92284010-92310479 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 92305064 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 105 (I105T)
Ref Sequence ENSEMBL: ENSMUSP00000144446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031364] [ENSMUST00000201143] [ENSMUST00000202870]
Predicted Effect probably benign
Transcript: ENSMUST00000031364
AA Change: I105T

PolyPhen 2 Score 0.111 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000031364
Gene: ENSMUSG00000029415
AA Change: I105T

DomainStartEndE-ValueType
Pfam:NUC130_3NT 62 113 3.3e-28 PFAM
low complexity region 116 126 N/A INTRINSIC
low complexity region 146 163 N/A INTRINSIC
low complexity region 224 239 N/A INTRINSIC
low complexity region 254 278 N/A INTRINSIC
Pfam:SDA1 409 532 2.4e-41 PFAM
Pfam:SDA1 519 685 2.8e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157998
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201084
Predicted Effect probably damaging
Transcript: ENSMUST00000201143
AA Change: I105T

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144446
Gene: ENSMUSG00000029415
AA Change: I105T

DomainStartEndE-ValueType
Pfam:NUC130_3NT 62 113 5.3e-24 PFAM
low complexity region 116 126 N/A INTRINSIC
low complexity region 146 163 N/A INTRINSIC
low complexity region 224 239 N/A INTRINSIC
low complexity region 254 277 N/A INTRINSIC
Pfam:SDA1 408 531 3.9e-37 PFAM
Pfam:SDA1 518 684 4.6e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201532
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202680
Predicted Effect probably benign
Transcript: ENSMUST00000202870
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.1%
  • 20x: 93.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A G 9: 57,257,643 S483P probably benign Het
2700081O15Rik A G 19: 7,420,274 D62G probably damaging Het
5730480H06Rik A G 5: 48,380,128 H169R probably damaging Het
Actn1 T A 12: 80,199,029 I127F probably damaging Het
AW822073 G A 10: 58,223,388 L515F probably damaging Het
Cadm3 T G 1: 173,341,171 T277P probably benign Het
Cast T C 13: 74,713,678 T629A probably damaging Het
Cblc C A 7: 19,792,561 C201F probably benign Het
Ccdc154 T A 17: 25,168,424 D375E possibly damaging Het
Cdk6 A G 5: 3,473,183 D201G probably damaging Het
Cep95 T C 11: 106,814,623 V478A probably benign Het
Ciita T C 16: 10,523,804 probably null Het
Clec4e A G 6: 123,283,694 F135S probably damaging Het
Cntn6 A G 6: 104,776,314 D337G possibly damaging Het
Crlf3 A T 11: 80,059,281 H174Q probably damaging Het
Cyb5r1 T A 1: 134,407,601 F93I probably damaging Het
Dopey2 T C 16: 93,755,486 I271T probably benign Het
Fcho1 T C 8: 71,715,725 Y218C probably damaging Het
Fhad1 C T 4: 141,903,990 M1297I probably benign Het
Igdcc4 T C 9: 65,121,813 V244A possibly damaging Het
Ikzf5 A G 7: 131,391,785 probably null Het
Ilvbl T A 10: 78,583,267 V450E probably damaging Het
Kcns3 T G 12: 11,091,478 N407H probably damaging Het
Klhl11 T C 11: 100,464,324 K224E possibly damaging Het
Klra17 T A 6: 129,868,693 D186V probably damaging Het
Lrrc37a T C 11: 103,498,437 D2054G probably benign Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Mrgbp A G 2: 180,584,446 N104S probably benign Het
Mroh2a GT GTT 1: 88,256,166 probably null Het
Muc5ac C A 7: 141,807,608 T1552N probably damaging Het
Muc5b T A 7: 141,856,698 Y1269* probably null Het
Myef2 T C 2: 125,097,981 probably null Het
Myg1 C T 15: 102,337,790 Q367* probably null Het
Nalcn T C 14: 123,294,343 N1365S possibly damaging Het
Nfu1 T C 6: 87,009,952 C18R probably benign Het
Nkx2-6 A T 14: 69,174,779 Q132L probably damaging Het
Olfr1085 T A 2: 86,658,360 I33F probably benign Het
Olfr516 C T 7: 108,845,414 A199T possibly damaging Het
Pak3 TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC TTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTC X: 143,743,893 probably benign Het
Prh1 A T 6: 132,571,833 Q101L unknown Het
Ribc2 A T 15: 85,132,914 probably null Het
Rnf19a C A 15: 36,253,005 R396L probably damaging Het
Sec24b G T 3: 130,041,311 Y79* probably null Het
Tatdn2 A G 6: 113,702,525 E277G possibly damaging Het
Tex10 A C 4: 48,451,952 F725V probably damaging Het
Themis3 T C 17: 66,559,753 D164G probably benign Het
Ubxn7 T C 16: 32,375,914 W220R probably damaging Het
Usp33 C A 3: 152,368,254 R246S probably damaging Het
Vmn2r102 T A 17: 19,676,781 V130E probably benign Het
Vmn2r112 C T 17: 22,618,949 P797L probably damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Yme1l1 T C 2: 23,186,250 V340A probably damaging Het
Other mutations in Sdad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Sdad1 APN 5 92303773 splice site probably null
IGL01355:Sdad1 APN 5 92302679 missense probably damaging 1.00
IGL01635:Sdad1 APN 5 92297160 missense probably damaging 0.98
IGL02166:Sdad1 APN 5 92291762 missense probably benign 0.03
IGL02503:Sdad1 APN 5 92301802 unclassified probably benign
IGL02739:Sdad1 APN 5 92290072 missense probably benign 0.43
PIT4468001:Sdad1 UTSW 5 92291918 missense probably damaging 1.00
R1169:Sdad1 UTSW 5 92298233 missense probably benign 0.32
R1496:Sdad1 UTSW 5 92309823 missense possibly damaging 0.94
R1844:Sdad1 UTSW 5 92305296 nonsense probably null
R1848:Sdad1 UTSW 5 92292651 critical splice donor site probably null
R2419:Sdad1 UTSW 5 92305818 missense possibly damaging 0.69
R2497:Sdad1 UTSW 5 92300099 missense probably benign 0.00
R2509:Sdad1 UTSW 5 92305825 missense probably benign 0.12
R4043:Sdad1 UTSW 5 92302694 missense probably damaging 0.96
R4384:Sdad1 UTSW 5 92298257 missense probably benign 0.01
R4477:Sdad1 UTSW 5 92297160 missense probably damaging 0.98
R4478:Sdad1 UTSW 5 92297160 missense probably damaging 0.98
R4734:Sdad1 UTSW 5 92304977 missense possibly damaging 0.61
R4749:Sdad1 UTSW 5 92304977 missense possibly damaging 0.61
R5135:Sdad1 UTSW 5 92303934 missense probably benign 0.00
R5288:Sdad1 UTSW 5 92286825 makesense probably null
R6331:Sdad1 UTSW 5 92303930 missense probably damaging 1.00
R7038:Sdad1 UTSW 5 92298190 critical splice donor site probably null
R7099:Sdad1 UTSW 5 92293973 missense possibly damaging 0.89
R7420:Sdad1 UTSW 5 92305737 missense possibly damaging 0.91
R7425:Sdad1 UTSW 5 92300121 missense probably benign 0.10
R7714:Sdad1 UTSW 5 92302679 missense probably damaging 1.00
R8048:Sdad1 UTSW 5 92300089 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGCATTCGGCCTATTTCCTGGAC -3'
(R):5'- GAGCATCTCAGTAACTTCCCGCAG -3'

Sequencing Primer
(F):5'- CTGGACTAGGGTCTCTAAGCATAAC -3'
(R):5'- AGCTGAAGGACCTGCTCTC -3'
Posted On2013-07-11