Incidental Mutation 'R7287:Secisbp2l'
ID566067
Institutional Source Beutler Lab
Gene Symbol Secisbp2l
Ensembl Gene ENSMUSG00000035093
Gene NameSECIS binding protein 2-like
Synonyms3110001I20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.271) question?
Stock #R7287 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location125736986-125782870 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 125740369 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1056 (S1056P)
Ref Sequence ENSEMBL: ENSMUSP00000055772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053699]
Predicted Effect probably benign
Transcript: ENSMUST00000053699
AA Change: S1056P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000055772
Gene: ENSMUSG00000035093
AA Change: S1056P

DomainStartEndE-ValueType
low complexity region 441 459 N/A INTRINSIC
low complexity region 555 568 N/A INTRINSIC
Pfam:Ribosomal_L7Ae 700 802 7.6e-24 PFAM
low complexity region 821 831 N/A INTRINSIC
low complexity region 970 978 N/A INTRINSIC
low complexity region 985 996 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139944
SMART Domains Protein: ENSMUSP00000121529
Gene: ENSMUSG00000035093

DomainStartEndE-ValueType
low complexity region 67 85 N/A INTRINSIC
low complexity region 181 194 N/A INTRINSIC
Pfam:Ribosomal_L7Ae 326 427 3.5e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (71/71)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik G A 11: 78,272,883 R1059H possibly damaging Het
Abca3 A G 17: 24,385,887 D656G possibly damaging Het
Abcc3 C T 11: 94,357,047 A1207T probably benign Het
Abcc8 T C 7: 46,113,110 H1209R probably damaging Het
Adam26a T C 8: 43,570,343 T37A possibly damaging Het
Adamts9 C T 6: 92,890,003 R685Q possibly damaging Het
Anapc7 T A 5: 122,433,436 N191K probably benign Het
Ankrd26 C T 6: 118,549,637 probably null Het
Ap5z1 T C 5: 142,474,047 L484P probably damaging Het
Arhgap32 A G 9: 32,152,697 D77G Het
Atp10a T A 7: 58,827,269 D1213E probably damaging Het
B3gnt8 T C 7: 25,628,970 L275P probably damaging Het
Cab39 A G 1: 85,818,461 E21G probably benign Het
Capn15 G T 17: 25,960,455 S948R probably damaging Het
Cbarp T C 10: 80,137,320 T15A unknown Het
Ccdc81 C T 7: 89,893,123 A182T probably damaging Het
Ccpg1 A G 9: 73,015,406 H766R probably benign Het
Cfl1 T C 19: 5,492,534 V14A probably benign Het
Chd6 A G 2: 161,008,392 I875T probably benign Het
Cidec T A 6: 113,428,398 E121D probably benign Het
Clpx C A 9: 65,300,013 Y64* probably null Het
Cntn1 T A 15: 92,245,952 probably null Het
Cyp24a1 A G 2: 170,485,906 L472P probably damaging Het
Dcdc2c G T 12: 28,516,686 D159E probably benign Het
Emp1 T C 6: 135,380,169 F82L probably benign Het
Fem1b T C 9: 62,796,122 T619A probably benign Het
Fgf15 A T 7: 144,896,794 D39V probably benign Het
Galnt12 T G 4: 47,108,525 F221V probably damaging Het
Herc6 A G 6: 57,651,980 probably null Het
Hspg2 G A 4: 137,529,556 V1537I probably benign Het
Ido2 T C 8: 24,535,138 probably null Het
Insr G A 8: 3,169,717 T935I probably benign Het
Itgax G A 7: 128,148,505 C1031Y probably damaging Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Kmt5b T C 19: 3,804,501 Y255H possibly damaging Het
Lrriq1 A T 10: 103,216,016 Y292N probably benign Het
Mrpl37 A G 4: 107,060,520 F318S probably damaging Het
Nav2 A G 7: 49,420,328 N311D probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nlrp9b T C 7: 20,028,456 C673R probably damaging Het
Npnt A G 3: 132,906,802 V74A probably benign Het
Olfr1335 T A 4: 118,809,742 T41S probably benign Het
Olfr378 T A 11: 73,425,843 I47F probably benign Het
Plce1 A T 19: 38,701,903 Q677L probably benign Het
Pmel C T 10: 128,715,226 Q113* probably null Het
Pom121l2 T A 13: 21,984,332 F924L probably benign Het
Poteg G A 8: 27,453,344 R214K probably null Het
Pprc1 G T 19: 46,071,354 S1480I unknown Het
Selenoo T C 15: 89,098,700 F477L probably benign Het
Senp2 A G 16: 22,018,364 D121G probably damaging Het
Slc25a11 T C 11: 70,645,355 D211G probably benign Het
Slc44a2 A G 9: 21,342,456 D131G probably benign Het
Tcf25 G A 8: 123,373,972 A34T possibly damaging Het
Tm9sf3 A G 19: 41,217,379 Y530H probably damaging Het
Tmco3 G A 8: 13,319,605 probably null Het
Tmem132d G T 5: 127,984,351 Q396K probably damaging Het
Tmem154 A G 3: 84,690,563 T136A possibly damaging Het
Tnrc6b A G 15: 80,879,541 T415A possibly damaging Het
Tonsl T C 15: 76,633,725 probably null Het
Ttyh1 T C 7: 4,125,658 Y185H probably benign Het
Ufl1 T A 4: 25,254,852 T535S probably benign Het
Vmn1r15 T C 6: 57,258,216 L23P possibly damaging Het
Vmn2r25 T A 6: 123,852,081 H78L possibly damaging Het
Vmn2r68 T C 7: 85,222,252 T608A probably benign Het
Vwf A G 6: 125,637,467 I1104V Het
Zbtb2 C T 10: 4,368,986 D347N possibly damaging Het
Zfyve9 A T 4: 108,718,256 S543T probably benign Het
Zhx1 T C 15: 58,053,296 N518S probably damaging Het
Zmym6 T C 4: 127,122,982 V852A possibly damaging Het
Other mutations in Secisbp2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Secisbp2l APN 2 125743856 missense probably damaging 0.99
IGL00644:Secisbp2l APN 2 125743844 missense probably damaging 1.00
IGL01093:Secisbp2l APN 2 125740325 missense probably benign
IGL01621:Secisbp2l APN 2 125773211 missense probably benign
IGL01955:Secisbp2l APN 2 125743812 critical splice donor site probably null
IGL02036:Secisbp2l APN 2 125758207 missense probably benign
IGL02045:Secisbp2l APN 2 125775578 missense possibly damaging 0.82
IGL02182:Secisbp2l APN 2 125747577 missense probably damaging 1.00
IGL02408:Secisbp2l APN 2 125740869 nonsense probably null
IGL02455:Secisbp2l APN 2 125773478 missense possibly damaging 0.89
IGL02953:Secisbp2l APN 2 125760274 missense probably benign 0.36
R0097:Secisbp2l UTSW 2 125771456 missense probably damaging 0.96
R0097:Secisbp2l UTSW 2 125771456 missense probably damaging 0.96
R1415:Secisbp2l UTSW 2 125740365 missense probably benign 0.00
R1626:Secisbp2l UTSW 2 125775686 missense probably damaging 0.99
R1926:Secisbp2l UTSW 2 125740677 missense probably damaging 0.99
R1940:Secisbp2l UTSW 2 125740339 missense probably damaging 1.00
R1970:Secisbp2l UTSW 2 125747510 missense probably damaging 1.00
R2100:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2240:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2252:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2253:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2472:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2474:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2475:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2990:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R2993:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3113:Secisbp2l UTSW 2 125750286 missense probably damaging 1.00
R3696:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3749:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3750:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3800:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3810:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3812:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3815:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3816:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3817:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R3880:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4077:Secisbp2l UTSW 2 125751865 splice site probably benign
R4096:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4097:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4164:Secisbp2l UTSW 2 125751883 intron probably benign
R4332:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4418:Secisbp2l UTSW 2 125752915 missense probably benign 0.00
R4598:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4600:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4602:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4603:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4678:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4679:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4684:Secisbp2l UTSW 2 125745942 missense probably damaging 1.00
R4741:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4749:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R4934:Secisbp2l UTSW 2 125740489 missense probably damaging 0.99
R5245:Secisbp2l UTSW 2 125747591 missense probably damaging 1.00
R5521:Secisbp2l UTSW 2 125752977 missense possibly damaging 0.94
R5547:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R5630:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R5631:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R5632:Secisbp2l UTSW 2 125740737 missense possibly damaging 0.66
R6039:Secisbp2l UTSW 2 125773216 missense probably benign 0.28
R6039:Secisbp2l UTSW 2 125773216 missense probably benign 0.28
R6378:Secisbp2l UTSW 2 125768325 missense possibly damaging 0.78
R6616:Secisbp2l UTSW 2 125768226 missense probably damaging 0.96
R6938:Secisbp2l UTSW 2 125750352 missense probably damaging 1.00
R7373:Secisbp2l UTSW 2 125757271 missense probably damaging 0.99
R7403:Secisbp2l UTSW 2 125760279 missense possibly damaging 0.73
R7484:Secisbp2l UTSW 2 125771532 nonsense probably null
R7504:Secisbp2l UTSW 2 125758171 missense probably benign 0.30
R7762:Secisbp2l UTSW 2 125768193 missense probably damaging 1.00
R7769:Secisbp2l UTSW 2 125771545 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- TGGACACTGTTAAAAGCAAAGTCAG -3'
(R):5'- GCACTCTTGTACCTGGCATG -3'

Sequencing Primer
(F):5'- CACTGTTAAAAGCAAAGTCAGAGATC -3'
(R):5'- GGATTATAGTCATGAGCCCACAGC -3'
Posted On2019-06-26